WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: spermatheca; Larval Expression: developing spermatheca; Primary Identifier  Expr6284
Remark  Also expressed in (comments from author) : Note: primers are not unique and produce 3 products. Can predict correct product. Strain: BC15966 Reporter Gene  [srh-87::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAAGAGTTCCGCATAGCAG] 3' and primer B 5' [TGCTCACACGATTTTCACAAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00005308 srh-87 H27D07.6 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023