WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; uterus; unidentified cells in tail ; Larval Expression: Reproductive System; developing uterus; unidentified cells in tail ; Primary Identifier  Expr6876
Remark  Strain: BC12786 Reporter Gene  [ced-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATACTTTCCCCGTCATCATTT] 3' and primer B 5' [CATATGGAACGCGATCTGAGTA] 3'.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
posterior region, from rectum to the end tail   WBbt:0005741
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000426 ced-12 Y106G6E.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023