WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: unidentified cells in head; Larval Expression: unidentified cells in head; Primary Identifier  Expr6870
Remark  Strain: BC11936 Reporter Gene  [jac-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTAAGCAGGCACACTTTCAGG] 3' and primer B 5' [CCCCGAGGAGATGATCTGT] 3'.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00002175 jac-1 Y105C5B.21 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023