WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00002175 Gene Name  jac-1
Sequence Name  ? Y105C5B.21 Brief Description  jac-1 encodes the C. elegans p120 catenin orthologue; by homology, JAC-1 is predicted to be a component of the cadherin-catenin complex (CCC); jac-1(RNAi) does enhance embryonic morphogenesis defects produced by weak loss-of-function mutations in hmp-1/alpha-catenin, suggesting that JAC-1 positively regulates cadherin-catenin function in the embryo; JAC-1 likely regulates this function by promoting association between the actin cytoskeleton and the cadherin-catenin complex; a JAC-1 reporter fusion localizes to embryonic adherens junctions in a manner that is dependent upon the presence of HMR-1/cadherin, with which it specifically interacts in the yeast two-hybrid system.
Organism  Caenorhabditis elegans Automated Description  Enables cadherin binding activity. Involved in embryonic body morphogenesis; regulation of actin cytoskeleton organization; and regulation of protein localization. Located in adherens junction. Part of catenin complex. Expressed in head. Human ortholog(s) of this gene implicated in several diseases, including DiGeorge syndrome; blepharocheilodontic syndrome 2; and oral squamous cell carcinoma. Is an ortholog of human ARVCF (ARVCF delta catenin family member).
Biotype  SO:0001217 Genetic Position  IV :14.5319 ±0.001559
Length (nt)  ? 29013
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00002175

Genomics

8 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:Y105C5B.21h.1 Y105C5B.21h.1 3350   IV: 15997835-16006357
Transcript:Y105C5B.21a.1 Y105C5B.21a.1 4055   IV: 15997839-16026847
Transcript:Y105C5B.21e.1 Y105C5B.21e.1 4061   IV: 15997839-16026847
Transcript:Y105C5B.21d.1 Y105C5B.21d.1 3334   IV: 15997855-16006367
Transcript:Y105C5B.21b.1 Y105C5B.21b.1 3255   IV: 15998129-16014403
Transcript:Y105C5B.21g.1 Y105C5B.21g.1 3261   IV: 15998129-16014403
Transcript:Y105C5B.21c.1 Y105C5B.21c.1 3546   IV: 15998129-16017489
Transcript:Y105C5B.21f.1 Y105C5B.21f.1 3552   IV: 15998129-16017489
 

Other

8 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:Y105C5B.21a Y105C5B.21a 3765   IV: 15998129-15998405
CDS:Y105C5B.21d Y105C5B.21d 3036   IV: 15998129-15998405
CDS:Y105C5B.21e Y105C5B.21e 3771   IV: 15998129-15998405
CDS:Y105C5B.21h Y105C5B.21h 3042   IV: 15998129-15998405
CDS:Y105C5B.21g Y105C5B.21g 3261   IV: 15998129-15998405
CDS:Y105C5B.21c Y105C5B.21c 3546   IV: 15998129-15998405
CDS:Y105C5B.21b Y105C5B.21b 3255   IV: 15998129-15998405
CDS:Y105C5B.21f Y105C5B.21f 3552   IV: 15998129-15998405

6 RNAi Result

WormBase ID
WBRNAi00055199
WBRNAi00036476
WBRNAi00080604
WBRNAi00101414
WBRNAi00092918
WBRNAi00101432

693 Allele

Public Name
otn10099
gk964078
gk964500
gk962765
gk963378
gk963590
gk963377
gk963795
gk963704
gk962529
gk963948
gk963888
WBVar01860443
WBVar01969469
gk220899
WBVar02073368
WBVar01734326
WBVar01734325
pkP972
gk718007
gk804783
WBVar00578014
WBVar00578015
WBVar01658181
WBVar02038247
pkP5252
WBVar02067908
WBVar00248273
WBVar02069985
WBVar02069986

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00002175 15997835 16026847 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_15997781..15997834   54 IV: 15997781-15997834 Caenorhabditis elegans

115 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
  Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector. p-value <= 0.05 WBPaper00066902:cat-1(RNAi)_regulated
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. DESeq2(v1.32.0), FDR < 0.05. WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching. Benjamini Hochberg corrected q-value < 0.01. WBPaper00053388:dauer_regulated_Cluster3
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. WBPaper00058958:100mGy-irradiation-72h_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed

10 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1031270 Tiling arrays expression graphs  
Strain: BC11936 [jac-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTAAGCAGGCACACTTTCAGG] 3' and primer B 5' [CCCCGAGGAGATGATCTGT] 3'. Expr6870 Adult Expression: unidentified cells in head; Larval Expression: unidentified cells in head;  
    Expr1020527 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.1592.xml [Y105C5B.21:gfp] transcriptional fusion. Chronogram570    
    Expr2012879 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1158736 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2583 JAC-1GFP is present at epidermal cell borders throughout morphogenesis. JAC-1GFP is present at the borders of intercalating cells in the dorsal epidermis. During ventral enclosure, JAC-1GFP concentrates at the lateral edges of cells near the leading edge and is observed at sites of cellcell contact at the ventral midline. JAC-1-GFP continues to localize to epidermal cell borders during elongation. JAC-1GFP and HMR-1 precisely colocalize in the epidermis. JAC-1GFP localizes apically with respect to AJM-1, a junctional component that localizes basally to HMR-1.
    Expr2584 In situ hybridization demonstrates that jac-1 mRNA is expressed in the early epidermis that lies on the dorsal posterior side of the embryo.  
    Expr12369   Anti-JAC-1 stained cell contacts.
    Expr2031113 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

22 GO Annotation

Annotation Extension Qualifier
  located_in
  part_of
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables
  involved_in
  enables
  enables
occurs_in(GO:0005912) enables
occurs_in(GO:0005912) enables
  located_in
  located_in
  located_in
  located_in
  involved_in
  located_in
  involved_in
  involved_in

23 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00002175 15997835 16026847 -1

22 Ontology Annotations

Annotation Extension Qualifier
  located_in
  part_of
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables
  involved_in
  enables
  enables
occurs_in(GO:0005912) enables
occurs_in(GO:0005912) enables
  located_in
  located_in
  located_in
  located_in
  involved_in
  located_in
  involved_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
29013

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00032899
WBStrain00001952

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_16026848..16026912   65 IV: 16026848-16026912 Caenorhabditis elegans