WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulva other; Larval Expression: Reproductive System; developing vulva; hypodermis; Primary Identifier  Expr7126
Remark  Strain: BC13222 Reporter Gene  [grl-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGGAATTGAAAATATTCGGTAA] 3' and primer B 5' [GCTTTGGATTTTGTCAGACTTTTT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
Epidermal layer. hypodermis epidermis WBbt:0005733
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001724 grl-15 Y75B8A.20 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023