WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: anal depressor muscle; unidentified cells in head; Larval Expression: anal depressor muscle; unidentified cells in head; Primary Identifier  Expr7187
Remark  Strain: BC12631 Reporter Gene  [ZK112.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGGCGAGAAAAATAAGAAGGCT] 3' and primer B 5' [ACGGTAGATTTGGATTTGGTATGT] 3'.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003559 ncl-1 ZK112.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023