WormMine: ExpressionPattern Expr9062

• Pattern: In transgenic animals that carried the Ppst-2a::egfp and pst-2a(fl)::egfp constructs, EGFP 2a fluorescence was specifically observed in intestinal and pharyngeal gland cells.
• Primary Identifier: Expr9062
• Remark: No GFP signal was observed in worms carrying Ppst-2b::egfp (translational fusion, forward primer 5- TTGACTCCTTTATTTGCCTGAAA 3, reverse primer 5- CATTGTTGCTACTGTGAAAAAGG 3). This suggested that the pst-2b promoter does not have inherent activity. Picture: Fig 6E, 6F.

2 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Secretory gland cell of the pharynx	Pharyngeal gland cell		WBbt:0005788

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00018827	pst-2	F54E7.1	Caenorhabditis elegans

0 Life Stages