WormMine: Gene WBGene00018827

• WormBase Gene ID: WBGene00018827
• Gene Name: pst-2
• Sequence Name: F54E7.1
• Brief Description: pst-2 encodes the C. elegans ortholog of the PAPST2 PAPS (3'-phospho-adenosine-5'-phosphosulfate) transporter; a pst-2::gfp reporter fusion is first expressed in ectodermal cells at the ~350-cell stage of embryogenesis; during larval stages, expression is seen in the intestine and, in the adult stage, in the vulva, with weak expression in the hypodermis; PST-2::GFP shows partial localization to the Golgi; pst-2 can partially complement developmental defects seen in pst-1 mutants, suggesting that pst-2 encodes a functional transporter but that it likely has some non-overlapping functions with pst-1 in vivo.
• Organism: Caenorhabditis elegans
• Automated Description: Enables 3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity. Involved in 3'-phosphoadenosine 5'-phosphosulfate transport. Located in Golgi cis cisterna membrane and Golgi medial cisterna membrane. Expressed in hypodermis; intestine; pharyngeal gland cell; and vulva. Is an ortholog of human SLC35B3 (solute carrier family 35 member B3).
• Biotype: SO:0001217
• Genetic Position: III :-1.45702 ±0.000643
• Length (nt): 1893

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00018827

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F54E7.1a.1	F54E7.1a.1	1272	III: 5680433-5682325
Transcript:F54E7.1b.1	F54E7.1b.1	744	III: 5681423-5682213

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F54E7.1a	F54E7.1a	1095	III: 5680498-5680604
CDS:F54E7.1b	F54E7.1b	744	III: 5681423-5681579

6 RNAi Result

• WBRNAi00048347
• WBRNAi00015639
• WBRNAi00006854
• WBRNAi00033637
• WBRNAi00107003
• WBRNAi00106890

28 Allele

• gk964518
• gk175200
• gk175193
• gk175194
• gk175195
• gk175196
• gk175197
• gk175198
• gk175199
• gk964338
• gk964339
• tm3316
• WBVar01445859
• WBVar01837616
• gk714754
• gk690362
• gk374450
• gk585106
• gk589869
• gk562337
• gk656709
• gk690846
• gk895525
• gk363904
• gk559144
• gk508505
• WBVar01566428
• ok3603

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00018827
• Start: 5680433
• End: 5682325
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

97 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_larva_enriched
	Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_larva_SelectivelyEnriched
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_E
	Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
	Transcripts that showed significantly decreased expression in alg-2(ok304), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-2(ok304)_downregulated
	Transcripts with significantly increased expression in isp-1(qm150) vs. N2, and in isp-1(qm150) ced-4(n1162) vs. ced-4(n1162).	Comparisons of each genotype were compared to the wild-type using the Empirical Base (Wright & Simon) algorithm and fold changes were represented on a log2 scale. A threshold of p < 0.05 and a fold change of 1.3 (log2) was set to determine differentially expressed targets.	WBPaper00045263:isp-1(qm150)_upregulated
	Transcripts with significantly increased expression in nuo-6(qm200) vs. N2, and in nuo-6(qm200);ced-4(n1162) vs. ced-4(n1162).	Comparisons of each genotype were compared to the wild-type using the Empirical Base (Wright & Simon) algorithm and fold changes were represented on a log2 scale. A threshold of p < 0.05 and a fold change of 1.3 (log2) was set to determine differentially expressed targets.	WBPaper00045263:nuo-6(qm200)_upregulated
	Genes that showed more than 1.5-fold decrease of expression following (Pore-Forming Toxin) PFT treatment by Cry5B.	Linear Models for Microarray Data (LIMMA) was used to determine a set differentially expressed genes. The cutoff p-value used was 0.01 with minimum 1.5 or 2 fold change.	WBPaper00038231:Cry5B_1.5-fold_downregulated
	Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C.	N.A.	WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
	Transcripts that showed significantly depleted expression in sensory neuron (labeled by iaIs25[Pgcy-37::GFP + unc-119(+)]) comparing to in whole worm.	Fold change > 2, p-value < 0.05.	WBPaper00060661:sensory-neuron_depleted
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched
Treatment with 0.2mM of HuminFeed until young adult stage (3 days).	Gene significantly up-regulated by treatment with 0.2mM of HuminFeed until young adult stage (3 days), with a minimum fold change in gene expression of 1.25.	For selection of DEGs, an unpaired t -test was performed followed by a significance analysis of microarray (SAM) test including a calculation that estimates the false discovery rate (FDR). FDR, reducing on the one hand type I errors for null associations, was set to a non-stringent level of <12.5%, mainly to guard from an increase of type II error and also based on findings by Levine et al. (2011), which described 12.5% as most acceptable optimum level of FDR, representing the 90th percentile of the normal distribution curve. DEGs exceeding a fold change of 1.25 were further analyzed with respect to their functional clustering. This fold-cut-off was chosen to allow an interpretation that is biologically meaningful, akin to the notion that data of sound technical and experimental quality which returns strong, statistically significant, absolute signal intensities is sufficiently robust to justify a fold-cut-off of >1.2. This analysis was conducted using the functional annotation clustering tool of the Database for Annotation, Visualization, and Integrated Discovery (DAVID; Huang et al., 2007).	WBPaper00041002:HF_3d_0.2mM_Up
Treatment with 2.0mM of HuminFeed until young adult stage (3 days).	Gene significantly up-regulated by treatment with 2.0mM of HuminFeed until young adult stage (3 days), with a minimum fold change in gene expression of 1.25.	For selection of DEGs, an unpaired t -test was performed followed by a significance analysis of microarray (SAM) test including a calculation that estimates the false discovery rate (FDR). FDR, reducing on the one hand type I errors for null associations, was set to a non-stringent level of <12.5%, mainly to guard from an increase of type II error and also based on findings by Levine et al. (2011), which described 12.5% as most acceptable optimum level of FDR, representing the 90th percentile of the normal distribution curve. DEGs exceeding a fold change of 1.25 were further analyzed with respect to their functional clustering. This fold-cut-off was chosen to allow an interpretation that is biologically meaningful, akin to the notion that data of sound technical and experimental quality which returns strong, statistically significant, absolute signal intensities is sufficiently robust to justify a fold-cut-off of >1.2. This analysis was conducted using the functional annotation clustering tool of the Database for Annotation, Visualization, and Integrated Discovery (DAVID; Huang et al., 2007).	WBPaper00041002:HF_3d_2.0mM_Up
	Transcripts that showed significantly decreased expression in sek-1(km4) animals comparing to in N2 animals under both dietary (DR, OP50 OD = 0.1) and ad libtum (AL, OP50 OD = 3) conditions from 3-day post L4 till 6-day post L4 adult hermaphrodite stage.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:sek-1(km4)_downregulated
Bacteria infection: Xenorhabdus nematophila	Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila.	Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets.	WBPaper00041606:CE_X.nematophila_regulated
feeding/starvation	A large cluster of genes up-regulated during early larval development..	For each average expression value, the larger of the model-based error and empirical error was reported. ANOVA and T-tests were also computed in Rosetta Resolver using the reported errors. Expression values, errors, and P-values corresponding to transcript detection, ANOVAs, and T-tests were exported from Rosetta Resolver and analyzed elsewhere.	WBPaper00032948:FedUp
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h).	Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the -1h timepoint.	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_EtBr-exposed_48h
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h).	Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)).	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_UVC-EtBr-exposed_48h

9 Expression Patterns

• Primary Identifier: Expr8857
• Remark: Picture: Fig. 5C.
• Pattern: Expression of the pst-2 reporter appears generally weaker than the pst-1 reporter. It is first seen at around the 350-cell stage and can be detected in ectodermal cells. During larval and adult stages, pst-2 reporter expression appears restricted to the intestine and, in the adult stage, also to the toroidal epithelial cells that constitute the vulva. In addition, the pst-2 reporter appears to be very weakly expressed in hypodermal tissues.

• Primary Identifier: Expr8858
• Remark: Picture: Fig 6B, 6C, 6D.
• Subcellular Localization: pst-1 and pst-2 reporter fusions only partially colocalize with both each other and a Golgi marker.

• Primary Identifier: Expr9062
• Remark: No GFP signal was observed in worms carrying Ppst-2b::egfp (translational fusion, forward primer 5- TTGACTCCTTTATTTGCCTGAAA 3, reverse primer 5- CATTGTTGCTACTGTGAAAAAGG 3). This suggested that the pst-2b promoter does not have inherent activity. Picture: Fig 6E, 6F.
• Pattern: In transgenic animals that carried the Ppst-2a::egfp and pst-2a(fl)::egfp constructs, EGFP 2a fluorescence was specifically observed in intestinal and pharyngeal gland cells.

• Primary Identifier: Expr9063
• Remark: Picture: Fig S4A, S4B, S4C.
• Subcellular Localization: The transporter proteins PST-1::EGFP and PST-2::EGFP co-localized with a marker of the Golgi apparatus, mCherry-tagged alpha-mannosidase II (AMAN-2). This suggested that PST-1 and PST-2 proteins resided in the Golgi. However, in merged images, it was apparent that, although PST-2::EGFP almost completely co-localized with AMAN-2, PST-1::EGFP only partly co-localized with AMAN-2. The localization of AMAN-2 is predicted to be in the cis/medial-Golgi compartments, rather than the trans-Golgi compartment; thus, these results suggested that PST-2, but not PST-1, was distributed primarily in the cis/medial-Golgi compartments.

• Primary Identifier: Expr1152144
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1038120
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2015140
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1011065
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2033378
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

16 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00018827
• Start: 5680433
• End: 5682325
• Strand: 1

16 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1893

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00037570

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_5680188..5680432
• Length (nt): 245
• Chromosome Location: III: 5680188-5680432
• Organism: Caenorhabditis elegans