WormMine: AnatomyTerm WBbt:0005829

• Definition: a large process bundle that runs along the vental mid-line extending from the ventral region of the nerve ring.
• Name: ventral nerve cord
• Primary Identifier: WBbt:0005829
• Synonym: ventral cord

0 Children

7 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Enriched in ventral nerve cord (adult).		WBPaper00029359_1166
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_larva_enriched
	Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_larva_SelectivelyEnriched
	Enriched in vulval muscle (adult), ventral nerve cord (larva), ventral nerve cord (adult), dorsal nerve cord (adult), body neurons (adult), body neurons (larva), tail neurons (larva), nerve ring (larva), dorsal nerve cord (larva), nerve ring (adult), body wall muscle (larva), lateral nerve cords/commissures (larva).		WBPaper00029359_1197
	Enriched in ventral nerve cord (larva), vulval muscle (adult), ventral nerve cord (adult), body neurons (adult), body neurons (larva), dorsal nerve cord (adult), tail neurons (larva), dorsal nerve cord (larva), nerve ring (adult), nerve ring (larva), tail neurons (adult), body wall muscle (larva).		WBPaper00029359_1291
	Enriched in vulval muscle (adult), ventral nerve cord (larva), ventral nerve cord (adult), dorsal nerve cord (adult), body neurons (adult), body neurons (larva), tail neurons (larva), nerve ring (larva), nerve ring (adult), dorsal nerve cord (larva), body wall muscle (larva), lateral nerve cords/commissures (larva), tail neurons (adult).		WBPaper00029359_1546

631 Expression Patterns

• Primary Identifier: Expr4895
• Remark: Picture: Figure S4F.
• Pattern: EVA-1::GFP expression was observed along the VNC, body wall muscles, Also expressed in pharyngeal muscles and hypodermis.
• Subcellular Localization: Exclusively localized on or near the cell surface membrane.

• Primary Identifier: Expr4821
• Remark: Picture: Fig. 10, A and B.
• Pattern: The hex-1 promoter was particularly active in coelomocytes as well as in neurons of the pharyngeal region and nerve cord, as compared with the head and tail pattern observed in strain BC14144 (see Expr6695). Expressed throughout the life-cycle.

• Primary Identifier: Expr4796
• Remark: Reporter gene fusion type not specified.
• Pattern: cnx-1 was expressed ubiquitously in every blastomere of the embryos up to the gastrulation stage but expression became gradually restricted to the head and tail regions at the comma stage during embryogenesis. During post-embryonic development, cnx-1 was expressed prominently in the H-shaped excretory cell, in the neurons of head and tail, in the dorsal and ventral nerve cords, and in the spermatheca. cnx-1 expression was also observed in the spicules of the male tail. The two head neurons expressing cnx-1 are ASK and ADL, and two tail neurons are PHA and PHB. Therefore, cnx-1 is expressed in head neurons including ASK and ASI chemosensory neurons and tail neurons including PHA and PHB.

• Primary Identifier: Expr4779
• Pattern: The fkb-6 transcript was temporally expressed in all stages from embryo to adult with predominant spatial expression being noted in the adult dorsal and ventral nerve cords. In addition, weaker spatial expression was noted in the pharynx, hypodermis, body wall muscle cells and some somatic and gut cells.

• Primary Identifier: Expr4767
• Pattern: Young embryos did not present a GFP signal, but expression was observed in late embryogenesis and at all stages of postnatal development: eggs, L1, L2, L3, L4, and adults. Adult animals showed stronger expression than did larval stages and eggs; this was also proved by RT-polymerase chain reaction (RT-PCR), suggesting potential developmental dynamics in atx-3 function. Both transgenic strains had a generalized expression pattern, with a strong signal in the spermatheca and vulval muscle . High fluorescence was observed in neuronal dorsal and ventral cord and neurons of the head and tail. Expression was also observed in the hypoderm, body muscles, and coelomocytes.

• Primary Identifier: Expr4956
• Remark: Picture: Fig. 5, Fig 6.
• Pattern: NAB-1::GFP expression is restricted to epithelia and neurons. The earliest expression was observed in the hypodermis of 2-fold-stage early embryos. Immediately prior to hatching, this expression became restricted to the epithelial excretory canal and the nervous system, including the central nervous system and the motoneurons (dorsal and ventral nerve cords. In L3 and L4 larvae, NAB-1::GFP also localized transiently at the membranes of the developing vulva epithelia. Also expressed in distal tip cell (pers. comm. from Wesley Hung 11-17-07.)
• Subcellular Localization: NAB-1::GFP puncta partially co-localized with the synaptic-vesicle protein SNT-1 and the active-zone protein UNC-10, suggesting that NAB-1 is present in presynaptic regions that are associated with vesicle pools and active zones. Similar to NAB-1, SAD-1 also showed co-localization with SNT-1. NAB-1::GFP and SAD-1 also showed partial co-localization, where each NAB-1::GFP punctum was associated with SAD-1 staining.

• Primary Identifier: Expr4940
• Pattern: strong bwm, vul, mu int, occaisonal weak pharyngeal, spermatheca, faint VNC, head neurons; embryonic bwm starts at 3-fold and very strong in L1s.

• Primary Identifier: Expr4938
• Pattern: strong head and tail bwm, vul, head and tail neurons, VNC (subset of neurons?), no embryonic seen

• Primary Identifier: Expr4939
• Pattern: faint to moderate, sparce bwm; VNC; no embryonic seen

• Primary Identifier: Expr4929
• Pattern: moderate vul muscle and VNC, faint and mosaic bwm; no embryonic seen

• Primary Identifier: Expr4900
• Remark: Picture: Figure 4.
• Pattern: UNC-69::GFP expression was first detectable in embryos. In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites. In older larvae and adults, UNC-69::GFP was expressed in neurons of the anterior, lateral, ventral and retro-vesicular ganglia in the head, and in neurons of the preanal, dorso-rectal and lumbar ganglia in the tail. The fusion protein was also present in the ventral nerve cord (VNC), in the dorsal nerve cord (DNC), in the dorsal and ventral sublateral nerve cords, and in commissural axons. The reporter was expressed in the neurons named CAN, HSN, ALM, PLM, AVM, PVM, BDU, and SDQR, as evidenced by its localization to the cell bodies of these neurons. Expression of unc-69 in these latter cells was confirmed using an unc-69::LacZ::NLS fusion.
• Subcellular Localization: In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites. In older larvae and adults, UNC-69::GFP was expressed in the cell bodies of neurons.

• Primary Identifier: Expr4390
• Reporter Gene: To test the tissue specificity of the expression of Caenorhabditis mannosidase II, a promoter gfp reporter construct was designed to generate a translational fusion. To select easily for the low copy number transformants carrying the aman-2::gfp reporter fusion, the 2000 bp upstream of the aman-2 gene were ligated into a vector carrying not only a gfp sequence but also the unc-119 gene and stably integrated into unc-119 (ed3) mutants. Two independent low copy number transgenic lines were generated and analyzed. The reporter plasmid used was a form of the pPD95.67 (L2459) promoterless gfp vector3. This vector was then modified by insertion of a HindIII/XbaI fragment carrying the unc-119 gene into its multiple cloning site to generate pPD95.67/unc-119. Then, a genomic fragment corresponding to the 2000 bp upstream of the aman-2 gene was isolated by PCR using the primers ManII_prom/1/XbaI gctctagacggacgagaagtacaaat and ManII_prom/2/XbaI gctctagacccatgctttatcttgccat. Both the fragment and the pPD95.67/unc-119 vector were cut with XbaI and ligated. A selected clone was sequenced and verified to contain the expected aman-2 upstream region and was used to transform unc-119 (ed3) mutants with a particle gun. --precise ends.
• Pattern: Confocal microscopy indicated that the aman-2 promoter is most active in the gut wall, pharynx and grinder, hypodermal cells, and cells of the nervous system (ventral nerve cord cells, neurons surrounding the pharyngeal bulb and in the head) in adult animals; also rather ubiquitous expression was seen in larvae.

• Primary Identifier: Expr4376
• Remark: Picture: Fig. 7.
• Pattern: ceGAT-1 is expressed in all of the GABA-ergic neurons. These GFP-positive neurons include the VD and DD neurons in the ventral cord, the RMED, RMEV, RMEL, RMER, AVL, and RIS neurons in the head area and the DVB neuron in the tail region. There are two additional GFP-positive neurons in the tail region. These two neurons are PVQR and PVQL. The identity of these GFP-positive neurons were confirmed by epifluorescence microscopy and by the location of the neurons as revealed by a combination of Nomarski-differential interference contrast microscopic observation and 4',6-diamidino-2-phenylindole nuclei-staining method. This expression pattern is evident from the early larva stage through the adult stage. An identical expression pattern was observed with at least 10 transgenic animals.

• Primary Identifier: Expr4346
• Pattern: The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located. No specific staining was found in animals that did not express any tagged nAChR subunit.
• Subcellular Localization: The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located.

• Primary Identifier: Expr4347
• Pattern: The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located. No specific staining was found in animals that did not express any tagged nAChR subunit.
• Subcellular Localization: The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located.

• Primary Identifier: Expr4348
• Pattern: ODR-2::HA was observed on cell surfaces in the nervous system. The protein was found on the cell bodies of many neurons in the head and tail, on many neuronal processes running along the major (dorsal and ventral) nerve cords, and on the surface of numerous sublateral nerve cords and circumferential commissures.
• Subcellular Localization: ODR-2 appeared to be evenly distributed on the surface of neuronal processes, i.e. not in a clustered fashion, even though varicosities along neuronal processes were clearly visible.

• Primary Identifier: Expr4349
• Pattern: Transgenic animals carrying this construct show GFP fluorescence in a variety of cells, with robust expression in the pharyngeal muscle. GFP expression was also observed in many neurons, including specific subsets in the head, pharynx, ventral nerve cord and anal ganglia.

• Primary Identifier: Expr4342
• Pattern: In first stage larvae (L1) of both sexes, ceh-22b::VENUS expression was not detected in SGPs(somatic gonadal precursor) at hatching, but became visible midway through the first larval stage (L1). After the SGP divided, the intensity of the reporter began to increase in distal SGP daughters (Z1.a and Z4.p) and began to diminish from proximal SGP daughters (Z1.p and Z4.a). In hermaphrodites, both progeny of the distal SGP daughter retained robust ceh-22b::VENUS expression through L2 or early L3. In males, the distal SGP daughter, which does not divide further, retained strong expression until L3; the expression decreased during L4. The ceh-22b::VENUS reporter was also expressed in the pharynx, intestine, and ventral nerve cord as well as in unidentified neurons in the head and tail. Expression in the pharynx and intestine was sustained throughout larval development into adulthood; expression in the ventral nerve cord was visible until L3.

• Primary Identifier: Expr4345
• Pattern: GFP expression is nearly ubiquitous in the early embryo. At early comma stage expression becomes intensely focused in the anterior of the embryo. Strong expression is observed from the pharynx and some unidentified head neurons beginning around the 1.5-fold stage. After hatching, GFP expression is present in the ALM and PLM neurons. Beginning in late L1 stages expression comes on in the PVD neurons and some time later in the AVM. No significant expression of GFP was observed in ventral cord commissural motoneurons.

• Primary Identifier: Expr4407
• Remark: No detailed description on cellular expression patterns in other tissues.
• Subcellular Localization: GLR-1::GFP puncta in the ventral nerve cord colocalize with presynaptic markers (synaptobrevin and a vesicular glutamate transporter).

• Primary Identifier: Expr4264
• Pattern: Expressed in body wall muscle cells, pharyngeal muscles, rectal gland cells, vulval and uterine muscles, and a subset of neurons in the head and ventral nerve cord. The expression was first detected in the embryo at the 1.5-fold stage and continued to be expressed until adulthood. In this stage, cells with position corresponding to P cells showed also GFP expression. In order to determine if the expression of GFP was in epidermal lineages, including P cells and their descendants, authors prepared double transgenic lines expressing GFP from promoter 1 of nhr-40 on the background of SU93 line that expresses an AJM::GFP membrane marker. This confirmed the expression of nhr-40::gfp in epidermal precursors P cells and their neuronal progeny within the ventral neuronal cord. However, the GFP was not observed in ventral epidermal cells that originated from P cells. The nhr-40::gfp was not observed in seam cells that are also marked by an AJM::GFP. The muscle pattern of expression was partially lost with truncations of this promoter fragments (-1013 and -682 bp); however, other aspects of expression were retained.

• Primary Identifier: Expr4266
• Pattern: Reporter genes that begin at -3190, -2021, -1248, and -517 bp upstream of the ATG of this alternate first exon 1 were expressed in body wall muscle cells, neurons in the head, nerve ring, ventral and dorsal nerve cords, neurons, and some epidermal cells in the tail. Weaker expression was also observed in pharyngeal muscles. The expression from promoter 2 started in the embryos at the 1.5-fold stage and was continuous throughout development. Expression from this internal promoter element is observed in vulval cells at the L4 stage and in adult hermaphrodites, including the uterine vulval cells uv1, 2, 3, and surrounding epithelium.

• Primary Identifier: Expr4244
• Pattern: ser-1::gfp expression was observed in the pharyngeal muscles. In addition, ser-1::gfp expression was observed in the vulval muscles, as well as in many neurons. ser-1::gfp is not detectable in HSN or VC.

• Primary Identifier: Expr4218
• Remark: Moreover, neither the dgn-1::GFP promoter reporter nor the rescuing DGN-1::GFP fusion show expression in muscle. Plasmid pJJ516 was made by inserting GFP from pPD114.38 into the HindIII site near the end of the dgn-1 coding sequence. The product contains GFP inserted after residue 575 of DGN-1, with the final seven DGN-1 residues at the C terminus. Expression of DGN-1::GFP is identical to that of the dgn-1::GFP promoter reporter, and DGN-1::GFP rescues the sterility of dgn-1(cg121).
• Pattern: In early (pre-morphological) embryos, dgn-1::GFP expression is evident in many epithelial and neural precursors comprising the outer layer of cells. As elongation begins at comma stage, expression becomes most prominent in several specialized epithelial cells, including pharyngeal e2 and marginal cells, excretory cells, the somatic gonad precursors (SGPs) Z1 and Z4, and rectal epithelial cells. Weaker expression is apparent in hypodermal precursors and neuroblasts along the ventral midline. Pharyngeal expression persists through the L3 larval stage, whereas excretory and rectal cell expression persists throughout development. SGP expression persists in SGP descendants, such as the distal tip cells (DTCs), and increases throughout the gonad during the L4 stage. Variable, generally weak expression is seen throughout larval development in several neurons, although PVP neurons show strong expression throughout development. Transient increased expression occurs in new P cell-derived neurons in the ventral nerve cord in late L1/early L2 stage animals. Variable weak expression is seen in hypodermal cells, principally hyp5 in the head. Preceding the L4/adult molt, expression increases in the vulval epithelium.

• Primary Identifier: Expr4590
• Pattern: Promoter activity with distinct GFP expression in lateral hypodermal seam cells and in the non-seam cell hypodermis was observed throughout development. Additionally, expression was noted in many neurons, including the ventral nerve cord (VNC) and the hermaphrodite specific neuron (HSN). GFP was also observed in various somatic gonad tissues including the anchor cell in larval stages and adult vulval muscle cells, the distal tip cells, a subset of the vulval precursor cells, uterine cells, and spermatheca.

• Primary Identifier: Expr4574
• Pattern: In wild-type animals, sax-7 is expressed in multiple tissues with robust SAX-7 accumulation in the nervous system. Expression was detected in pharynx, gonad, and the nerve ring and ventral nerve cord.

• Primary Identifier: Expr4679
• Remark: sin-3 = pqn-28 according to this paper.
• Pattern: When the sin-3 expression profile was examined in transgenic animals using a gfp reporter driven by a 1.5 kb sin-3 5'-flanking sequence, the sin-3::gfp signal was detected in all the ray structural cells. In addition, sin-3::gfp expression was observed in the inner labial neurons, socket cells, the cephalic neurons in the head region and the ventral nerve cord from L1 to adult stage.

• Primary Identifier: Expr4663
• Pattern: ppk-1::GFP expression was observed in such somatic tissues as gonad sheath and spermatheca, distal tip cells, and uterine and vulva muscles. ppk-1::GFP also showed extensive expression in such neuronal cells as ventral nerve cord, neuronal cell bodies near the nerve ring, and tail neurons.

• Primary Identifier: Expr4648
• Pattern: Transgenic lines generated with the full-length protein fusion construct (for example, ljEx114) expressed TRPA-1:: GFP in the same cells as ljEx107 (see Expr4646), but with some additional cells, including the majority of amphid sensory neurons (for example, ASH, AWA, AWB, ASI and ASK) and the phasmid neurons PHA and PHB. The full-length TRPA-1:: GFP fusion was also expressed in the PVD and PDE in the postdeirid sensilla and the sensory neurons OLQ and IL1. Other neurons in the head and ventral nerve cord also expressed TRPA-1:: GFP.
• Subcellular Localization: The fusion protein was observed at the cilia of sensory neurons, as well as at the cell body.

• Primary Identifier: Expr4490
• Remark: No detailed description on expression pattern in other life stage.
• Pattern: Expressed in ventral nerve cord from L2 to adult, anterior neurons (not individually identified in this study) from L2 to adult, posterior neurons from L2 to adult, pharynx from L2 to adult, specific pair of head neurons from L2 to adult, posterior cells (not individually identified in this study) from L2 to adult.

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
entity of anatomical origin that is either entirely acellular or is a collection of cells and acellular parts.	Anatomy	anatomical structure	WBbt:0005766
Part of the nervous system that lies completely outside the pharynx.	somatic nervous system		WBbt:0005760