WormMine: ExpressionPattern Expr4390

• Pattern: Confocal microscopy indicated that the aman-2 promoter is most active in the gut wall, pharynx and grinder, hypodermal cells, and cells of the nervous system (ventral nerve cord cells, neurons surrounding the pharyngeal bulb and in the head) in adult animals; also rather ubiquitous expression was seen in larvae.
• Primary Identifier: Expr4390
• Reporter Gene: To test the tissue specificity of the expression of Caenorhabditis mannosidase II, a promoter gfp reporter construct was designed to generate a translational fusion. To select easily for the low copy number transformants carrying the aman-2::gfp reporter fusion, the 2000 bp upstream of the aman-2 gene were ligated into a vector carrying not only a gfp sequence but also the unc-119 gene and stably integrated into unc-119 (ed3) mutants. Two independent low copy number transgenic lines were generated and analyzed. The reporter plasmid used was a form of the pPD95.67 (L2459) promoterless gfp vector3. This vector was then modified by insertion of a HindIII/XbaI fragment carrying the unc-119 gene into its multiple cloning site to generate pPD95.67/unc-119. Then, a genomic fragment corresponding to the 2000 bp upstream of the aman-2 gene was isolated by PCR using the primers ManII_prom/1/XbaI gctctagacggacgagaagtacaaat and ManII_prom/2/XbaI gctctagacccatgctttatcttgccat. Both the fragment and the pPD95.67/unc-119 vector were cut with XbaI and ligated. A selected clone was sequenced and verified to contain the expected aman-2 upstream region and was used to transform unc-119 (ed3) mutants with a particle gun. --precise ends.

5 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
a large process bundle that runs along the vental mid-line extending from the ventral region of the nerve ring.	ventral nerve cord	ventral cord	WBbt:0005829
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00010284	aman-2	F58H1.1	Caenorhabditis elegans

5 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The second stage larva. At 25 Centigrade, it ranges 25.5-32.5 hours after fertilization, 11.5-18.5 hours after hatch.		L2 larva Ce	WBls:0000027
	The fourth stage larva. At 25 Centigrade, it ranges 40-49.5 hours after fertilization, 26-35.5 hours after hatch.		L4 larva Ce	WBls:0000038
	The first stage larva. At 25 Centigrade, it ranges 14-25.5 hours after fertilization, 0-11.5 hours after hatch.		L1 larva Ce	WBls:0000024
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	The third stage larva. At 25 Centigrade, it ranges 32.5-40 hours after fertilization, 18.5-26 hours after hatch.		L3 larva Ce	WBls:0000035