WormMine: ExpressionPattern Expr5299

• Pattern: Adult Expression: pharynx; body wall muscle; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; body wall muscle; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr5299
• Remark: Strain: BC12707
• Reporter Gene: [C18A3.5a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTCGTTCATAATGCTGCG] 3' and primer B 5' [TGAAGAAGGAGATGGCTTAAATG] 3'.

4 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
posterior region, from rectum to the end	tail		WBbt:0005741
anterior-most body region containing the pharynx.	head		WBbt:0005739

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00015943	tiar-1	C18A3.5	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023