WormMine: AnatomyTerm WBbt:0003822

• Definition: right intestinal muscle cell, attach to intestine and body wall anterior to anus
• Name: mu_int_R
• Primary Identifier: WBbt:0003822
• Synonym: lineage name: MSppaapp

1 Children

Definition	Name	Synonym	Primary Identifier
nucleus of pedigree MSppaapp	MSppaapp nucleus		WBbt:0002437

0 Expression Clusters

130 Expression Patterns

• Primary Identifier: Expr5291
• Remark: Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. Strain: BC10173
• Reporter Gene: [C17G10.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGAAGATATGCCTTCTAGG] 3' and primer B 5' [CGCGTCGAGAGATTACTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5272
• Remark: Also expressed in (comments from author) : Intestinal expression is mosaic. Strain: BC10066
• Reporter Gene: [hsp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCAACAAACGAATAATAG] 3' and primer B 5' [tttgtgtttgatttattttcctg] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; coelomocytes; Nervous System; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; Nervous System; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5244
• Remark: Strain: BC10060
• Reporter Gene: [hsp-70::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCCATTTCTTAAATGCAG] 3' and primer B 5' [atttcagcgtttgaatagca] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Larval Expression: stomato-intestinal muscle; anal depressor muscle

• Primary Identifier: Expr5246
• Remark: Strain: BC11926
• Reporter Gene: [C12D8.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGAATGTGTACGAACGATCTG] 3' and primer B 5' [TCCTTCGATTTGATTCACAAAGT] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5191
• Remark: Strain: BC14332
• Reporter Gene: [C06G1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATAAAATCTGCGCTGTGC] 3' and primer B 5' [ACCCTTTGCTCTCGCAAGT] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; vulval muscle; gonad sheath cells; body wall muscle; seam cells; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; seam cells

• Primary Identifier: Expr5187
• Remark: Also expressed in (comments from author) : High intensity GFP.Mosaic population. Strain: BC10396
• Reporter Gene: [C06E7.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCACAGTGATAGGTACGAGTTCA] 3' and primer B 5' [GCGAGATTTTGTTTGGTTGTAAG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; seam cells; Nervous System; nerve ring; head neurons; unidentified cells; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; seam cells; Nervous System; nerve ring; head neurons; unidentified cells

• Primary Identifier: Expr5175
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16156
• Reporter Gene: [C05D11.7b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATATGATGTTTTGTGTGCG] 3' and primer B 5' [GTGATTTTCTGGAAAAGAACAAAA] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5177
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15051
• Reporter Gene: [ife-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACAGCTAATTGCGAAGAATGAA] 3' and primer B 5' [ACGTTTCAGCTTCGATCTCTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5110
• Remark: Also expressed in (comments from author) : high intensity GFP, other tissues may be masked Strain: BC12752
• Reporter Gene: [C02E11.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAGGTCAAATTTTCGTCGATT] 3' and primer B 5' [TAAAGAACCGATGATCTGGAAAA] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5494
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11019
• Reporter Gene: [ost-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCAATAAACAAAACACATCTGG] 3' and primer B 5' [GACGGCGAATGAAGAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head

• Primary Identifier: Expr5485
• Remark: Strain: BC15358
• Reporter Gene: [rpl-34::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCGATGAGACATTTCCGA] 3' and primer B 5' [TAACGCGGAGGGAGATTTTT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5481
• Remark: Strain: BC10579
• Reporter Gene: [eif-3.H::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAGGGTTTTACCTCCAAAGAA] 3' and primer B 5' [GCTGTCGAGATTTTTGATAACC] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; vulval muscle; body wall muscle; excretory cell; Nervous System; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell; Nervous System; tail neurons

• Primary Identifier: Expr5476
• Remark: Also expressed in (comments from author) : High intensity GFP.Mosaic population. Strain: BC14155
• Reporter Gene: [rab-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTAAGCCAAAGCCAAAGCC] 3' and primer B 5' [TGCTGCCATCTCCTTTTTG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; Reproductive System; distal tip cell; developing gonad; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5460
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14164
• Reporter Gene: [C37C3.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; head mesodermal cell; Nervous System; neurons along body; Larval Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; body wall muscle; head mesodermal cell; Nervous System; neurons along body

• Primary Identifier: Expr5461
• Remark: Strain: BC15734
• Reporter Gene: [ppn-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; coelomocytes; Nervous System; head neurons; neurons along body; Larval Expression: stomato-intestinal muscle; anal depressor muscle; body wall muscle; coelomocytes; Nervous System; head neurons; neurons along body

• Primary Identifier: Expr5466
• Remark: Strain: BC15422
• Reporter Gene: [C37H5.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGTTATCCTATTTTCTCCCG] 3' and primer B 5' [TGTTGGAAGACGTGATCTGC] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5459
• Remark: Strain: BC11970
• Reporter Gene: [C37C3.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; coelomocytes; unidentified cells in body ; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; coelomocytes; unidentified cells in body

• Primary Identifier: Expr5421
• Remark: Also expressed in (comments from author) : Intense GFP expression made it hard to resolve some tissues. Strain: BC10161
• Reporter Gene: [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5419
• Remark: Strain: DM13747
• Reporter Gene: [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; Nervous System; nerve ring; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5394
• Remark: Strain: BC14389
• Reporter Gene: [C30H7.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTGTCACCTGAAATGTTCGTT] 3' and primer B 5' [CCACCGCAGGATTTCTGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; Nervous System; nerve ring; ventral nerve cord; head neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing spermatheca; Nervous System; nerve ring; ventral nerve cord; head neurons

• Primary Identifier: Expr5381
• Remark: Strain: BC14421
• Reporter Gene: [C29H12.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGGAAATTGTCGACTGCT] 3' and primer B 5' [GCCACGATCTTGTCTGAAACTAT] 3'.
• Pattern: Adult Expression: intestine; stomato-intestinal muscle; Reproductive System; vulval muscle; coelomocytes; Nervous System; ventral nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: intestine; stomato-intestinal muscle; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5333
• Remark: Strain: BC15292
• Reporter Gene: [C25A1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTGTTCCACTCATCTCTTCG] 3' and primer B 5' [TATCCCGATATTTTCCACTGAAAT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca uterine valve; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5320
• Remark: Strain: BC12301
• Reporter Gene: [frm-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTCAACTTGCTCCCAACTC] 3' and primer B 5' [TACCCCTGGAAACACGAAAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; distal tip cell; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; distal tip cell; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5312
• Remark: Strain: BC10523
• Reporter Gene: [rpy-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTTGCAATGATTTTTCAAGTC] 3' and primer B 5' [CGTCGATGATTCGTGATGAG] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Larval Expression: anal depressor muscle; body wall muscle

• Primary Identifier: Expr5313
• Remark: Also expressed in (comments from author) : Beautiful intestinal muscle. Strain: BC10720
• Reporter Gene: [rpy-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTTGCAATGATTTTTCAAGTC] 3' and primer B 5' [CGTCGATGATTCGTGATGAG] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; Larval Expression: stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5303
• Remark: Also expressed in (comments from author) : Might have seen seam cells but we were unsure. Strain: BC12525
• Reporter Gene: [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; Nervous System; head neurons; neurons along body; unidentified cells; Larval Expression: pharynx; body wall muscle; hypodermis; Nervous System; head neurons; neurons along body; unidentified cells

• Primary Identifier: Expr5304
• Remark: Also expressed in (comments from author) : early embryo is only gut. Strain: DM12525
• Reporter Gene: [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterus; vulva other; gonad sheath cells; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; tail neurons; unidentified cells in head; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head

• Primary Identifier: Expr5305
• Remark: Also expressed in (comments from author) : Unidentified cells in head and tail, possibly neural. Strain: BC10484
• Reporter Gene: [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing gonad; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5403
• Remark: Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated. Strain: BC11111
• Reporter Gene: [C32F10.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TACCGTATGAAGTTTAAAGGCACA] 3' and primer B 5' [GTACGGTTCGGATGCTGTAAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; intestine; Nervous System; head neurons

• Primary Identifier: Expr5070
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11109
• Reporter Gene: [B0416.5a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGCACGATTTTCCTACAAATAA] 3' and primer B 5' [AGCGCCGATTTTGCTTTT] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; stomato-intestinal muscle; Nervous System; ventral nerve cord; head neurons; tail neurons

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
intestinal muscle cell, attach to intestine and body wall anterior to anus	intestinal muscle	stomato-intestinal muscle	WBbt:0005796
embryonic cell	MSppaap		WBbt:0005913