WormMine: ExpressionPattern Expr5494

• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head
• Primary Identifier: Expr5494
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11019
• Reporter Gene: [ost-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCAATAAACAAAACACATCTGG] 3' and primer B 5' [GACGGCGAATGAAGAGGA] 3'.

13 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	posterior distal tip cell	gon herm dtc P	WBbt:0004506
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	anterior distal tip cell	gon herm dtc A	WBbt:0004520
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents.	anal depressor muscle	dilator muscle	WBbt:0004292
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
muscle lining of the uterine wall.	uterine muscle		WBbt:0005342
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis.	gonadal sheath cell		WBbt:0005828
Head mesodermal cell, function unknown	head mesodermal cell	hmc	WBbt:0004697
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003893	ost-1	C44B12.2	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023