WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: pharynx; unidentified cells in head; Primary Identifier  Expr5013
Remark  Strain: BC13522 Reporter Gene  [csn-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTGTGGTCGGAAACTTTGA] 3' and primer B 5' [TCGTCACCCATTATTCTGTCC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000814 csn-2 B0025.2 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023