WormMine: ExpressionPattern Expr5641

• Pattern: Adult Expression: intestine - posterior cells; Nervous System; head neurons; amphids; unidentified cells in tail ; Larval Expression: intestine - posterior cells; Nervous System; head neurons; amphids; unidentified cells in tail
• Primary Identifier: Expr5641
• Remark: Also expressed in (comments from author) : ASH amphid neuron; Also expression in a non-DiI stained, non-ASE/AWC head neuron pair sending dendrite to tip of nose (Hobert Lab 2005). Strain: BC13449
• Reporter Gene: [srx-47::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTCAATTAGCTTGACACGAAA] 3' and primer B 5' [TCAATCAACGCGTATATAACCTG] 3'.

5 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
posterior region, from rectum to the end	tail		WBbt:0005741
neuron of the amphid sensillum	amphid neuron	amphid sensory neuron	WBbt:0005394

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00005938	srx-47	E02C12.3	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023