WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: Nervous System; head neurons; amphids; Primary Identifier  Expr5894
Remark  Also expressed in (comments from author) : No comments. Strain: BC13708 Reporter Gene  [sra-17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCAGGCTATTCAAGCTTTC] 3' and primer B 5' [TGGTTGATAGTTTTTCTTGTCGAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron of the amphid sensillum amphid neuron amphid sensory neuron WBbt:0005394

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00005043 sra-17 F28C12.1 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023