WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: intestine; Nervous System; nerve ring; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; tail neurons; Primary Identifier  Expr6435
Remark  Also expressed in (comments from author) : Embryo incomplete. Strain: BC12140 Reporter Gene  [amt-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATATTTTGGAGGGAAATACGTCAA] 3' and primer B 5' [CCGGTCCTGCGATTATTCT] 3'.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000135 amt-3 M195.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023