WormMine: ExpressionPattern Expr6706

• Pattern: Adult Expression: Nervous System; head neurons; PVT interneuron; tail neurons; Larval Expression: Nervous System; head neurons; PVT interneuron; tail neurons
• Primary Identifier: Expr6706
• Remark: Strain: BC15234
• Reporter Gene: [grd-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGGCACATATCCGTCGAT] 3' and primer B 5' [CGTGATCCGAATTGTGACTG] 3'.

4 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
Neuron class of one interneuron, projects along ventral cord to ring.	PVT	lineage name: ABplpappppa	WBbt:0004070
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00001695	grd-6	T18H9.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023