WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: body wall muscle; hypodermis; unidentified cells in head; unidentified cells in tail ; Larval Expression: body wall muscle; hypodermis; unidentified cells in head; unidentified cells in tail ; Primary Identifier  Expr6220
Remark  Strain: BC11475 Reporter Gene  [alh-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGATGGCTTGCAGATGACA] 3' and primer B 5' [TGCAAAAATGAGAATAAAATGAGC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
posterior region, from rectum to the end tail   WBbt:0005741
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000112 alh-6 F56D12.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023