WormMine: Gene WBGene00000366

• WormBase Gene ID: WBGene00000366
• Gene Name: cbp-1
• Sequence Name: R10E11.1
• Brief Description: cbp-1 encodes a homolog of the mammalian transcriptional cofactors CBP (OMIM:600140) and p300 (E1A-BINDING PROTEIN, 300-KD; OMIM:602700) that have been shown to possess histone acetyltransferase activity, and which, when mutated, lead to Rubinstein-Taybi syndrome (OMIM:180849) and colorectal cancer (OMIM:114500); at least one splicing form of CBP-1 exhibits histone acetyltransferase (HAT) activity in vitro and has a glutamine/asparagine-rich domain; CBP-1 is required during embryogenesis for differentiation of all non-neuronal somatic cell types; CBP-1 is expressed very early in embryogenesis, suggesting that it may interact with maternally provided transcription factors, such as SKN-1, to specific developmental fates.
• Organism: Caenorhabditis elegans
• Automated Description: Enables RNA polymerase II-specific DNA-binding transcription factor binding activity; histone acetyltransferase activity; and lysine N-acetyltransferase activity, acting on acetyl phosphate as donor. Involved in several processes, including positive regulation of transcription by RNA polymerase II; regulation of distal tip cell migration; and spermatogenesis. Located in cytoplasm and nucleus. Expressed in alimentary system; distal tip cell; head; and tail. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; Huntington's disease; Rubinstein-Taybi syndrome; and leukemia (multiple). Is an ortholog of human CREBBP (CREB binding protein).
• Biotype: SO:0001217
• Genetic Position: III :0.996159 ±0.002046
• Length (nt): 8317

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000366

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R10E11.1a.2	R10E11.1a.2	6664	III: 9766509-9774807
Transcript:R10E11.1b.1	R10E11.1b.1	7131	III: 9766510-9774825
Transcript:R10E11.1a.1	R10E11.1a.1	7090	III: 9766516-9774823
Transcript:R10E11.1c.1	R10E11.1c.1	7005	III: 9766516-9774825

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R10E11.1a	R10E11.1a	6021	III: 9766698-9766737
CDS:R10E11.1b	R10E11.1b	6054	III: 9766698-9766737
CDS:R10E11.1c	R10E11.1c	5934	III: 9766698-9766737

128 RNAi Result

• WBRNAi00084535
• WBRNAi00084536
• WBRNAi00084538
• WBRNAi00106747
• WBRNAi00097500
• WBRNAi00051692
• WBRNAi00084541
• WBRNAi00084539
• WBRNAi00084540
• WBRNAi00066910
• WBRNAi00085498
• WBRNAi00051693
• WBRNAi00009058
• WBRNAi00091049
• WBRNAi00006037
• WBRNAi00007168
• WBRNAi00082115
• WBRNAi00082119
• WBRNAi00082121
• WBRNAi00082120
• WBRNAi00082126
• WBRNAi00034814
• WBRNAi00113350
• WBRNAi00101707
• WBRNAi00084642
• WBRNAi00026076
• WBRNAi00082125
• WBRNAi00084533
• WBRNAi00084532
• WBRNAi00065751

121 Allele

• gk964518
• gk963887
• WBVar01267267
• WBVar01267268
• WBVar01267270
• gk944475
• gk944476
• h11912
• ok1491
• ku258
• syb7456
• WBVar00602767
• gk398948
• gk408645
• gk314668
• gk717909
• WBVar00100944
• gk759155
• gk522288
• gk877204
• gk535579
• gk346752
• gk835654
• gk716339
• gk498112
• gk513701
• gk440498
• gk390812
• gk772929
• gk495376

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000366
• Start: 9766509
• End: 9774825
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_9774826..9776622
• Length (nt): 1797
• Chromosome Location: III: 9774826-9776622
• Organism: Caenorhabditis elegans

151 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage.	DESeq, FDR < 0.05	WBPaper00055626:pry-1(mu38)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral

14 Expression Patterns

• Primary Identifier: Expr2009742
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6494
• Remark: Strain: BC12977
• Reporter Gene: [cbp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAGCTGGTAAAGTCGACTGAATA] 3' and primer B 5' [ATGGTGGTTCATCCATCAATTAG] 3'.
• Pattern: Adult Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; amphids; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; amphids; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr6495
• Remark: Strain: BC14167
• Reporter Gene: [cbp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAGCTGGTAAAGTCGACTGAATA] 3' and primer B 5' [ATGGTGGTTCATCCATCAATTAG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Nervous System; head neurons; Larval Expression: pharynx; intestine; Nervous System; head neurons

• Primary Identifier: Expr6493
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13810
• Reporter Gene: [cbp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAGCTGGTAAAGTCGACTGAATA] 3' and primer B 5' [ATGGTGGTTCATCCATCAATTAG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Nervous System; nerve ring; head neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; hypodermis; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr1030194
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr14852
• Pattern: cbp-1 is strongly expressed in many tissues including intestine, pharynx, hypodermis, body wall muscles, and nervous system.

• Primary Identifier: Expr11788
• Pattern: cbp-1p::RFP expression was detected in most somatic cells, especially those that make up the alimentary system, confirming previous expression profiles. Analysis of dissected gonads revealed that the DTCs also expressed RFP in stages L2, L3, and L4 as well as in young adults, indicating that cbp-1 is expressed throughout DTC migration.

• Primary Identifier: Expr9120
• Remark: Picture: Figure 2i.
• Pattern: CBP-1 protein is first detectable in nuclei beginning at the two-cell stage, and this ubiquitous nuclear staining persists at least through the 100-cell stage of embryogenesis. This nuclear staining is completely absent in cbp-1(RNAi) embryos.

• Primary Identifier: Chronogram480
• Remark: Original chronogram file: chronogram.1489.xml
• Reporter Gene: [R10E11.1:gfp] transcriptional fusion.

• Primary Identifier: Chronogram748
• Remark: Original chronogram file: chronogram.1786.xml
• Reporter Gene: [R10E11.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1155366
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2027982
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr3748
• Subcellular Localization: CBP-1 was predominantly localized to the nuclei of most if not all somatic cells. Importantly, CBP-1 was found in the nuclei of the VPCs during the late L2 larval stage which corresponds to the time of let-60 Ras signaling and vulval induction.

• Primary Identifier: Expr1017429
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

35 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000366
• Start: 9766509
• End: 9774825
• Strand: 1

35 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 8317

1 Sequence Ontology Term

• Name: gene

6 Strains

• WBStrain00026532
• WBStrain00036243
• WBStrain00040749
• WBStrain00040750
• WBStrain00002490
• WBStrain00002432

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_9765149..9766508
• Length (nt): 1360
• Chromosome Location: III: 9765149-9766508
• Organism: Caenorhabditis elegans