WormMine: Gene WBGene00000871

• WormBase Gene ID: WBGene00000871
• Gene Name: cye-1
• Sequence Name: C37A2.4
• Brief Description: cye-1 encodes the sole C. elegans E-type cyclin; CYE-1 is required for progression through the mitotic cell cycle during embryonic, larval, and germline development; cye-1 is also required for endoreduplication in intestinal cells; CYE-1 is expressed ubiquitously in nuclei during embryonic development and postembryonically in proliferating blast cells, including germline stem cells; in the germline, CYE-1 levels are negatively regulated in meiotic cells by a CUL-1, SKR-1/2, PROM-1 SCF ubiquitin ligase.
• Organism: Caenorhabditis elegans
• Automated Description: Enables cyclin-dependent protein serine/threonine kinase regulator activity. Involved in several processes, including developmental process involved in reproduction; regulation of mitotic cell cycle; and regulation of protein localization. Located in nucleus. Part of chromatin. Expressed in several structures, including germ line; gonad; and male sex myoblast. Human ortholog(s) of this gene implicated in carcinoma (multiple); cervix uteri carcinoma in situ; and urinary bladder cancer. Is an ortholog of human CCNE1 (cyclin E1) and CCNE2 (cyclin E2).
• Biotype: SO:0001217
• Genetic Position: I :1.31709 ±0.00085
• Length (nt): 3599

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000871

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C37A2.4b.1	C37A2.4b.1	2105	I: 6780799-6784397
Transcript:C37A2.4a.1	C37A2.4a.1	2106	I: 6780806-6784396

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C37A2.4a	C37A2.4a	1575	I: 6780821-6780897
CDS:C37A2.4b	C37A2.4b	1566	I: 6780821-6780897

37 RNAi Result

• WBRNAi00072820
• WBRNAi00067006
• WBRNAi00067084
• WBRNAi00067123
• WBRNAi00067318
• WBRNAi00067481
• WBRNAi00067627
• WBRNAi00067682
• WBRNAi00067919
• WBRNAi00067922
• WBRNAi00024765
• WBRNAi00024764
• WBRNAi00072819
• WBRNAi00105922
• WBRNAi00084457
• WBRNAi00078995
• WBRNAi00116666
• WBRNAi00008132
• WBRNAi00027836
• WBRNAi00022990
• WBRNAi00022991
• WBRNAi00003112
• WBRNAi00072821
• WBRNAi00022860
• WBRNAi00042091
• WBRNAi00063801
• WBRNAi00063802
• WBRNAi00098883
• WBRNAi00086536
• WBRNAi00106612

39 Allele

• gk962858
• gk962706
• gk963902
• gk471616
• gk594879
• gk606829
• h312
• gk757330
• ku256
• gk584279
• gk374345
• eh10
• h11820
• gk623198
• gk963804
• gk462597
• gk113656
• gk462598
• gk113657
• gk113658
• gk424134
• WBVar01909707
• gk461716
• os66
• gk643122
• gk808487
• gk699165
• gk598159
• gk845287
• gk922031

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000871
• Start: 6780799
• End: 6784397
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_6784398..6784867
• Length (nt): 470
• Chromosome Location: I: 6784398-6784867
• Organism: Caenorhabditis elegans

167 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Transcripts that were regulated by both set-6(ok2195) and baz-2(tm0235) at 2-day post L4 adult hermaphrodite stage.	N.A.	WBPaper00059356:set-6(ok2195)_baz-2(tm0235)_regulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L2-larva_expressed

14 Expression Patterns

• Primary Identifier: Expr4661
• Pattern: CYE-1::GFP was expressed in the Z1.a/Z4.p cells before their division. Within 2 hrs after their division, the GFP signal decreased in the Z1.aa/Z4.pp but not in the Z1.ap/Z4.pa cells. Therefore, CYE-1 is expressed asymmetrically between the daughters of the Z1.a/Z4.p cells. Similar asymmetric expression was also detected using a cye-1 promoter::GFP fusion gene (cye-1p::gfp), which lacks the cye-1 coding sequence, indicating that the asymmetry is regulated at the transcriptional level.

• Primary Identifier: Expr5454
• Remark: Strain: BC12151
• Reporter Gene: [cye-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAACTCACACTTTGGAGCA] 3' and primer B 5' [GACTTTCTTCCAGCGATTTTGA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons

• Primary Identifier: Expr5455
• Remark: Strain: BC13217
• Reporter Gene: [cye-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAACTCACACTTTGGAGCA] 3' and primer B 5' [GACTTTCTTCCAGCGATTTTGA] 3'.
• Pattern: Adult Expression: pharynx; Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons

• Primary Identifier: Expr1030538
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2347
• Pattern: CYE-1 is present in adult animals and is restricted to the germline, which is the only proliferative tissue in adults. CYE-1 levels vary in the germline. Mitotic germ cells in the distal region of the gonad have easily detectable levels of nuclear CYE-1. Germ cells in the initial stages of meiosis (proximal to the mitotic germ cells) have lower CYE-1 levels. Finally, as oocytes cellularize in the loop region of the gonad, CYE-1 levels increase with mature oocytes having the highest levels of nuclear CYE-1. These results demonstrate that a significant portion of maternal cye-1 contribution to the embryo is CYE-1 protein. CYE-1 level was assayed postembryonically to determine whether CYE-1 could be detected and if levels of CYE-1 correlated with mitotic proliferation. CYE-1 protein is detectable in larval blast cells that give rise to all tissue types, including, germline, intestine, hypodermis, neurons, and muscle. During larval stages, the level of CYE-1 protein is much lower than that found in germ cells or in the early embryo. CYE-1 antibody staining is restricted to the developmental time when the blast cells are undergoing active proliferation. For example, in the L1 stage, proliferating P blast cells that produce ventral nerve cells have relatively high levels of nuclear CYE-1. In contrast, during the L2 larval stage, the nonproliferating neuronal descendents of the P blast cells have CYE-1 levels that are only barely detectable above background. Further, while a subset of the P cell descendents, the vulva precursor cells (VPCs), will proliferate in the L3 larval stage to produce the vulva, these cells do not have appreciable CYE-1 levels while they are quiescent in the L2 larval stage. Nuclear CYE-1 becomes detectable in the VPCs during the L3 larval stage when they begin proliferation. CYE-1 becomes undetectable in the VPC descendents after completion of cell divisions in L4 larval stage animals. Monoclonal anti-CYE-1 antibody was used to assay CYE-1 levels from fertilization to the end of embryogenesis. In the zygote, CYE-1 is observed in the maternal and paternal pronuclei as soon as they form. The specificity of antibody staining was confirmed by cye-1 RNAi treatment of adult hermaphrodites that abolishes both oocyte nuclei and embryonic anti-CYE-1 protein staining. In early embryos, CYE-1 is enriched in nuclei, and levels appear constant with no evidence of cell cycle fluctuations other than during mitosis. During mitosis, CYE-1 antibody staining appears diffuse once nuclear envelope breakdown occurs, but resumes nuclear localization upon reformation of the nuclear envelope in telophase. CYE-1 is present equally in all cells of the early embryo. The level of CYE-1 declines during embryogenesis and disappears from most cells in comma-stage embryos coincident with the completion of the majority of embryonic cell divisions.
• Subcellular Localization: nuclear

• Primary Identifier: Expr10646
• Pattern: CYE-1 is expressed at a low level throughout the mitotic zone but at a higher level in its middle.

• Primary Identifier: Expr2010654
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2346
• Pattern: Expression was first detected during early embryogenesis(28-cell stage) and continued in all proliferating cells of the embryo. Once on, the GFP reporter showed no fluctuation in levels during the embryonic cell cycle and was continuous until proliferation of the lineage was complete. Expression postembryonically was detected in all proliferating somatic cell lineages of the hermaphrodite throughout development and remained constant while the lineage was proliferating. Expression was specifically assayed in the P and seam cell lineages, several neurons outside the ventral nerve cord, vulval precursor cells (VPCs), intestinal cells, and the somatic gonad. Reporter gene expression was usually lost once cell divisions were complete, although persistent expression was often seen in seam cells, intestinal cells, and scattered neurons. Germline expression of the cye-1::GFP reporter gene was not observed, presumably reflecting germline silencing of the simple, extrachromosomal arrays generated in these experiments. Because the germline and early embryos are CYE-1 antibody-positive, authors have attempted to visualize germline CYE-1::GFP fusion proteins by using complex arrays and germline promoters, but all attempts have been unsuccessful.

• Primary Identifier: Expr1020533
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr13012
• Pattern: Pcye-1::gfp reporter is only transiently expressed in the VPCs at the lateG1/early S-phase.

• Primary Identifier: Expr1146089
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1319
• Remark: Original chronogram file: chronogram.251.xml
• Reporter Gene: [C37A2.4:gfp] transcriptional fusion.

• Primary Identifier: Expr14516
• Subcellular Localization: Immunofluorescent localization of CYE-1, YFP-CDK-2 and SAS-4 (a centriole marker) indicated that CYE-1 and CDK-2 colocalize around the sperm chromatin in a small (<2 μm) ring with an intense focus at the centrioles.

• Primary Identifier: Expr2028894
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

39 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000871
• Start: 6780799
• End: 6784397
• Strand: 1

39 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes upregulated by CYE-1/CDK-2AF for more than two fold.	Statistical analysis was through MAANOVA. In a fixed effect analysis, sample, array, and dye effects were modeled. P-values were determined by a permutation F2-test, in which residuals were shuffled 5000 times globally. Probes with p < 0.05 after family-wise error correction were considered significantly changed.	WBPaper00040426:CYE-1_CDK-2AF_upregulated
	Genes downregulated by CYE-1/CDK-2AF for more than two fold.	Statistical analysis was through MAANOVA. In a fixed effect analysis, sample, array, and dye effects were modeled. P-values were determined by a permutation F2-test, in which residuals were shuffled 5000 times globally. Probes with p < 0.05 after family-wise error correction were considered significantly changed.	WBPaper00040426:CYE-1_CDK-2AF_downregulated

1 Sequence

• Length: 3599

1 Sequence Ontology Term

• Name: gene

7 Strains

• WBStrain00023759
• WBStrain00023600
• WBStrain00054805
• WBStrain00007987
• WBStrain00006744
• WBStrain00002038
• WBStrain00002504

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_6780152..6780798
• Length (nt): 647
• Chromosome Location: I: 6780152-6780798
• Organism: Caenorhabditis elegans