WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00000931 Gene Name  dao-5
Sequence Name  ? C25A1.10 Brief Description  dao-5 encodes a predicted nucleolar phosphoprotein related to Saccharomyces cerevisiae SRP40 and the vertebrate Nopp140 proteins that may play a role in rRNA gene transcription and nucleolar structural organization; dao-5 expression is negatively regulated by the DAF-2/insulin-like receptor and positively regulated by the DAF-16/fork-head transcription factor, suggesting that dao-5 may be involved in life-span determination; dao-5 is strongly expressed in dauer larvae; DAO-5 localizes to nucleoli.
Organism  Caenorhabditis elegans Automated Description  Enables RNA polymerase I core binding activity and rDNA binding activity. Involved in several processes, including determination of adult lifespan; insulin receptor signaling pathway; and nucleolar large rRNA transcription by RNA polymerase I. Located in nucleolus and nucleoplasm. Expressed in germline precursor cell; gonadal sheath cell; hypodermis; and somatic cell. Is an ortholog of human NOLC1 (nucleolar and coiled-body phosphoprotein 1).
Biotype  SO:0001217 Genetic Position  I :4.73079 ±0.002326
Length (nt)  ? 3351
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00000931

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C25A1.10a.1 C25A1.10a.1 3158   I: 10187546-10190896
Transcript:C25A1.10b.1 C25A1.10b.1 2091   I: 10187772-10190880
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C25A1.10a C25A1.10a 2916   I: 10187772-10187930
CDS:C25A1.10b C25A1.10b 2091   I: 10187772-10187930

3 RNAi Result

WormBase ID
WBRNAi00041137
WBRNAi00003005
WBRNAi00075870

34 Allele

Public Name
gk962858
gk962706
gk963902
gk963849
tm11402
gk120259
gk496412
gk120260
ok5542
gk482809
gk867774
gk347229
WBVar00538852
gk596384
gk707556
gk903025
WBVar01910252
gk417442
gk475008
gk326170
gk484878
gk712074
tm7332
gk579735
gk837990
WBVar01932358
gk604750
gk769740
gk716783
gk120255

1 Chromosome

WormBase ID Organism Length (nt)
I Caenorhabditis elegans 15072434  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00000931 10187546 10190896 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

153 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts that showed significantly increased expression after exposure to 75uM paraquat(PQ) from L1 to day 2 adult stage in skn-1(lax188) animals fold change > 2 WBPaper00058711:paraquat_upregulated
Temprature shift to 28C for 24 hours. Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours. Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_48h_downregulated
  Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:Cisplatin_downregulated_WT
  Proteins that showed significantly decreased expression in 1-day-old sek-1(km4) adults comparing to in wild type animals, both with 6 hours of cisplatin treatment. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:sek-1(km4)_downregulated_cisplatin
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:excretory-cell_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
  Transcripts that showed significantly decreased expression in rbr-2(tm3141) comparing to in N2 animals. Mapped reads were analyzed for transcript assembly and differential expression using Cufflinks 2.1.1 with a filter of twofold difference and FDR correction (P < 0.05). WBPaper00050080:rbr-2(tm3141)_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals. Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed. WBPaper00062193:skn-1(RNAi)_upregulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Proteins interacting with HA-PPM-1.D. N.A. WBPaper00062498:PPM-1.D_interacting
  Transcripts that showed significantly decreased expression in pfd-6(gk493446); daf-2(e1370) comparing to in daf-2(e1370). Limma version 3.24.15. Fold change < 0.67 (p < 0.05). WBPaper00055827:pfd-6(gk493446)_downregulated
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector. DESeq2. FDR < 0.05. WBPaper00060459:bcat-1(RNAi)_downregulated

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC14778 [dao-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGCAGCAAGAGTTGGAT] 3' and primer B 5' [ACAAGTCGGAACTGATAGCGA] 3'. Expr5332 Adult Expression: pharynx; body wall muscle; Nervous System; nerve ring; head neurons; Larval Expression: pharynx; intestine; body wall muscle; Nervous System; nerve ring; head neurons;  
    Expr1030580 Tiling arrays expression graphs  
Temporal description   Expr10101   Every germline nucleus displays a single large DAO-5-positive nucleolus. In the 2-cell stage embryo, the DAO-5 signal consists of 15-25 small dots of varying intensity distributed throughout each nucleus. Nucleolus-like structures were never observed at this early stage. The first appearance of a nucleolar structure occurs at the 6- to 8-cell stage, when larger spherical bodies (~0.5 mm in diameter) are immunodetected amidst the dot-like signals. Shortly after, the number of small dot-like signals that are detected decreases drastically (but some persist until later stages) and, except for the germline cell, all embryonic nuclei then harbor one or, in the vast majority, two distinct DAO- 5 or FIB-1 signals of equal size and intensity. This pattern remains broadly similar throughout embryogenesis, with the notable exception that intestinal nuclei often contain a single large DAO-5/FIB-1 positive nucleolus at later stages. It should be noted that at all embryonic stages examined, a substantial pool of diffuse nucleoplasmic DAO-5 was also detected. In the adult, the localization of DAO-5 was examined in more detail in the polyploid intestinal nuclei, which contain a large centrally-located nucleolus. In these nucleoli, the DAO-5 signal describes a hollow sphere that surrounds a DNA-poor core. In addition to being present in this portion of the nucleolus, DAO-5 is found in numerous small punctate structures throughout the nucleoplasm of intestinal nuclei. The DAO-5/FIB-1 positive nucleoplasmic foci that we observe in early C. elegans embryos are reminiscent of the prenucleolar bodies that are detected in the last stages of mitosis and that coalesce on rDNA in early G1.
    Expr11751 DAO-5::GFP was expressed in nucleoli in various tissues including nerve ring, intestine, sheath cells and hypodermis.  
    Expr2010789 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2029026 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1017844 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1200377 Data from the TransgeneOme project  
    Expr1145169 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

16 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in

6 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00000931 10187546 10190896 -1

16 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
3351

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00030111
WBStrain00035691

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_10190897..10191272   376 I: 10190897-10191272 Caenorhabditis elegans