WormMine: Gene WBGene00001089

• WormBase Gene ID: WBGene00001089
• Gene Name: dre-1
• Sequence Name: K04A8.6
• Brief Description: dre-1 encodes an ortholog of human FBXO11/PRMT9 (OMIM:607871, associatedwith vitiligo and otitis media) that is required, in conjunction withDAF-12 and its partners, for global developmental timing of thetransistion from larval to adult cell fates; DRE-1 has an N-terminalF-box domain, three central tandem C-terminal CASH domains, and aC-terminal zinc finger; hypomorphic dre-1 mutations are syntheticallyheterochronic with loss-of-function daf-12 alleles, inducing defectivedistal tip cell migration and precocious fusion of seam cells; fivedifferent hypomorphic dre-1 alleles alter conserved glycine residues inthe CASH domain region, whereas the null dre-1(hd60) allele is lethal atthe three-fold embryo stage; DRE-1 is expressed in many tissues,including epidermal and distal tip cells, and localizes to both nucleusand cytoplasm; strong loss-of-function of dre-1 (the dh99 mutant fedRNAi) induces defects at all four molts; dre-1 also has syntheticphenotypes with daf-9(k182), daf-36(k114), and lin-29(n546); dre-1-likeenhancement of daf-12 is also seen in skr-1(RNAi), cul-1(RNAi), orrbx-1/2(RNAi) animals; DRE-1 and SKR-1 bind one another, as do theirhuman orthologs; DRE-1 affects lin-29 expression, and is suppressed bylin-42(RNAi); DRE-1 is paralogous to C. elegans BE0003N10.3.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable zinc ion binding activity. Involved in several processes, including mesodermal cell migration; nematode larval development; and positive regulation of apoptotic process involved in development. Located in cytoplasm and nucleus. Expressed in several structures, including P5.ppp; gonad; hypodermis; non-striated muscle; and vulva. Human ortholog(s) of this gene implicated in breast carcinoma; gastrointestinal system cancer (multiple); and lung non-small cell carcinoma. Is an ortholog of human FBXO11 (F-box protein 11).
• Biotype: SO:0001217
• Genetic Position: V :0.05417 ±0.006328
• Length (nt): 12887

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001089

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K04A8.6a.1	K04A8.6a.1	3315	V: 6533614-6538062
Transcript:K04A8.6a.2	K04A8.6a.2	3451	V: 6533617-6546500
Transcript:K04A8.6b.1	K04A8.6b.1	3069	V: 6533990-6546491

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K04A8.6a	K04A8.6a	2811	V: 6533990-6534116
CDS:K04A8.6b	K04A8.6b	3069	V: 6533990-6534116

19 RNAi Result

• WBRNAi00095671
• WBRNAi00086623
• WBRNAi00000623
• WBRNAi00049875
• WBRNAi00033935
• WBRNAi00066799
• WBRNAi00086615
• WBRNAi00073179
• WBRNAi00073178
• WBRNAi00073180
• WBRNAi00093909
• WBRNAi00106833
• WBRNAi00112018
• WBRNAi00086612
• WBRNAi00116302
• WBRNAi00086613
• WBRNAi00107036
• WBRNAi00107048
• WBRNAi00098039

179 Allele

• gk963301
• gk963553
• gk963042
• gk963041
• gk964259
• gk964351
• gk963850
• gk801586
• WBVar01740763
• otn11403
• WBVar01973859
• WBVar01973858
• WBVar01973860
• WBVar01973861
• gk237511
• gk237510
• gk237509
• gk237508
• gk237507
• gk237486
• gk237489
• gk237488
• gk237487
• gk237496
• gk237495
• gk237494
• gk237493
• gk237492
• gk237491
• gk237490

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001089
• Start: 6533614
• End: 6546500
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_6533061..6533613
• Length (nt): 553
• Chromosome Location: V: 6533061-6533613
• Organism: Caenorhabditis elegans

175 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Top 300 transcripts enriched in excretory duct, excretory pore according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Excretory_duct_and_pore
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Reduced humidity (98% relative humidity).	Genes that were down-regulated after one day exposure to reduced humidity (98% relative humidity) according to microarray analysis.	Multiple hypothesis testing with the Benjamini-Hochberg correction was applied on calculated p-values. A change in the expression level was considered to be significant if the adjusted p-value was less than 0.001.	WBPaper00044578:reduced-humidity_downregulated_microarray
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed

13 Expression Patterns

• Primary Identifier: Expr4547
• Reporter Gene: For dre-1::gfp, a 4 kb promoter was amplified with primers 5' -GGTACCCGAGGGGACATCGAGATAG-3' and 5' -GGTACCTTCCTGGCCAACCAGAGAC-3' and was cloned into Fire vector L3781 (BA 279). The dre-1 ORF and the dre-1 3' UTR region were amplified with primers 5' -GCTAGCATGTCGTCCTCTTCGTCAC-3' and 5' -ACTAGTTACTTACTCCACTCCACACAG-3' and were cloned into BA279 (BA280). Lines containing this construct included dhEx346 and dhIs442. To obtain the full-length promoter construct, authors substituted the promoter from BA279 with a 12.3 kb promoter by using primers 5' -GCGGCCGCGTTGCACACAAAACATTATTATTTTCTTTCTCTT-3' and 5' -TACGTATCTCGTCCCTGAGATCTCTCATTT-3' (BA508). Resulting lines containing this array included dhEx443 and dhEx452. --precise ends.
• Pattern: First detected by midembryogenesis, expression was most prominent in epidermal and intestinal cells. By the 1.5-fold stage of embryogenesis, expression was additionally detected in neurons and other cells. During larval and adult stages, DRE-1::GFP was most visible in epidermal seam cells and hypodermis. Expression was high in larvae and low in adults. In addition, DRE-1 was strongly expressed in the P epidermal blast cells and descendents that give rise to the vulva. Weak expression was seen in the somatic gonad, including the gonadoblasts, the anchor cell, dtcs, and occasionally adult spermatheca and uterus. Notably, with another construct (dhEx346, 4 kb promoter, 4 kb coding region), dtc expression was stronger and commenced by mid-L3. In the musculature, DRE-1 was seen in the pharynx, anal depressor, sex muscles, and body wall muscles. Finally, DRE-1 was detected in neurons of the head, tail, ventral cord, and periphery.
• Subcellular Localization: Generally, DRE-1::GFP was localized to both the nucleus and cytoplasm, and it was broadly expressed, including in phenotypically affected tissues.

• Primary Identifier: Expr1030694
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6320
• Remark: Strain: BC12671
• Reporter Gene: [K04A8.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAGCGGTGTCGTCTGCTCT] 3' and primer B 5' [CAGAGACGATGTCGGTCCTT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; unidentified cells; Larval Expression: pharynx; body wall muscle; unidentified cells

• Primary Identifier: Expr6321
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10432
• Reporter Gene: [K04A8.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAGCGGTGTCGTCTGCTCT] 3' and primer B 5' [CAGAGACGATGTCGGTCCTT] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; neurons along body; tail neurons; Larval Expression: pharynx; body wall muscle; Nervous System; tail neurons; unidentified cells

• Primary Identifier: Expr11674
• Remark: Temporal description
• Pattern: BLMP-1::GFP showed overlapping expression with DRE-1::GFP in seam and hypodermal cells as well as the dtcs. DRE-1::GFP levels in the dtcs increased steadily from L2 to L4.

• Primary Identifier: Expr13614
• Remark: Strain UL1949
• Pattern: The earliest expression for the gene K04A8.6, chosen based on data in the C. elegans Expression Pattern Consortium database, was also detected in 3-fold embryos. Nuclear localised expression was found in bodywall muscles, hypodermis and the pharyngeal muscles in all post-embryonic stages with the addition of vulval muscles within adults. The fluorescence was not uniform in any of these nuclei; there were regions where fluorescence was absent giving the nuclei a speckled appearance. The majority of expressing nuclei were concentrated in the anterior of the worm, with other nuclei in the tail corresponding to the tail hypodermal cells. Hyp7 and bodywall muscle nuclei were also visible. Very occasionally a punctate distribution of the fusion protein was observed in single adult bodywall muscle cells with some fluorescence remaining in the nucleus. When this non-nuclear localisation of the fusion protein was seen, the fluorescence was arranged in well-separated puncta, which were brighter than the surrounding nuclei in intensity and therefore very distinct.

• Primary Identifier: Expr2011087
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1153581
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram2077
• Remark: Original chronogram file: chronogram.992.xml
• Reporter Gene: [K04A8.6:gfp] transcriptional fusion.

• Primary Identifier: Expr2029323
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr10745
• Pattern: dre-1 promoter::GFP is robustly expressed in the tail- spike cell but not in the surrounding hyp10 hypodermal cell that forms the tail spike.

• Primary Identifier: Chronogram1743
• Remark: Original chronogram file: chronogram.66.xml
• Reporter Gene: [K04A8.6:gfp] transcriptional fusion.

• Primary Identifier: Expr1016852
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

26 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001089
• Start: 6533614
• End: 6546500
• Strand: -1

26 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 12887

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00036922
• WBStrain00037225
• WBStrain00001341
• WBStrain00002251
• WBStrain00000025

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_6546501..6548578
• Length (nt): 2078
• Chromosome Location: V: 6546501-6548578
• Organism: Caenorhabditis elegans