WormMine: Gene WBGene00001173

• WormBase Gene ID: WBGene00001173
• Gene Name: egl-4
• Sequence Name: F55A8.2
• Brief Description: egl-4 encodes a cyclic GMP-dependent protein kinase that may act through the TGF-beta signaling pathway to relay sensory cues that modulate chemosensory behavior, dauer formation, foraging, egg laying, body size, and endoreduplication in response to dietary restriction; egl-4 is also required for lethargus, a sleep-like state that is induced before each of the four larval molts; in addition, genetic studies indicate that egl-4 may also act through daf-16 to regulate adult lifespan; an egl-4::gfp promoter fusion is expressed in body wall muscle, head neurons, hypodermis, and the intestine.
• Organism: Caenorhabditis elegans
• Automated Description: Enables cGMP-dependent protein kinase activity. Involved in several processes, including enzyme-linked receptor protein signaling pathway; regulation of multicellular organismal process; and regulation of signal transduction. Located in cytosol and nucleus. Expressed in several structures, including marginal cell; nerve ring; neurons; spermatheca; and vulval muscle. Used to study ciliopathy. Human ortholog(s) of this gene implicated in thoracic aortic aneurysm. Is an ortholog of human PRKG1 (protein kinase cGMP-dependent 1).
• Biotype: SO:0001217
• Genetic Position: IV :-14.5826 ±0.536803
• Length (nt): 32526

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001173

Genomics

9 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F55A8.2a.2	F55A8.2a.2	2780	IV: 1848071-1880562
Transcript:F55A8.2h.1	F55A8.2h.1	3002	IV: 1848071-1880589
Transcript:F55A8.2a.1	F55A8.2a.1	3000	IV: 1848071-1880596
Transcript:F55A8.2b.1	F55A8.2b.1	2214	IV: 1849665-1879939
Transcript:F55A8.2e.1	F55A8.2e.1	3101	IV: 1854230-1880591
Transcript:F55A8.2c.1	F55A8.2c.1	2900	IV: 1858557-1880589
Transcript:F55A8.2d.1	F55A8.2d.1	588	IV: 1871011-1879939
Transcript:F55A8.2g.1	F55A8.2g.1	1455	IV: 1871828-1879939
Transcript:F55A8.2f.1	F55A8.2f.1	1541	IV: 1873310-1879939

Other

8 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F55A8.2f	F55A8.2f	1413	IV: 1873438-1873455
CDS:F55A8.2a	F55A8.2a	2343	IV: 1848071-1848226
CDS:F55A8.2b	F55A8.2b	2214	IV: 1849665-1849691
CDS:F55A8.2c	F55A8.2c	2250	IV: 1858557-1858619
CDS:F55A8.2d	F55A8.2d	588	IV: 1871011-1871270
CDS:F55A8.2e	F55A8.2e	2232	IV: 1854447-1854491
CDS:F55A8.2g	F55A8.2g	1455	IV: 1871828-1871887
CDS:F55A8.2h	F55A8.2h	2352	IV: 1848071-1848226

8 RNAi Result

• WBRNAi00089843
• WBRNAi00048443
• WBRNAi00032848
• WBRNAi00092902
• WBRNAi00089921
• WBRNAi00090081
• WBRNAi00090239
• WBRNAi00115693

849 Allele

• gk963722
• WBVar00569263
• WBVar00569264
• WBVar00569265
• WBVar00569269
• WBVar00569270
• WBVar00569273
• WBVar00569291
• gk963025
• gk963102
• gk964255
• otn12252
• WBVar02067784
• WBVar02067783
• WBVar02067782
• WBVar02067781
• WBVar02067788
• WBVar02067787
• WBVar02067786
• WBVar02067785
• WBVar02067777
• WBVar02067776
• WBVar02067779
• WBVar02067778
• WBVar02067780
• WBVar02069780
• gk194944
• gk194945
• gk194946
• gk194941

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001173
• Start: 1848071
• End: 1880596
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_1880597..1900986
• Length (nt): 20390
• Chromosome Location: IV: 1880597-1900986
• Organism: Caenorhabditis elegans

169 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated

17 Expression Patterns

• Primary Identifier: Expr1030750
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6197
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12721
• Reporter Gene: [egl-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAATTTGCTTTTTCGGTGAA] 3' and primer B 5' [TGCTGCTTGATCATCTTTTCATA] 3'.
• Pattern: Adult Expression: intestine - . cells

• Primary Identifier: Expr806
• Remark: This expression pattern is referred as the pattern cgk-1C in the article. Cosmid number and sequence of cgk-1C was not given in the article but deduced by curators.
• Pattern: Expression was observed in a subset of neurons in the head, nerve ring, and ventral nerve cord including some motor neurons. pcgk-1C::GFP was also found in several neurons in the tail, one of these was PQR. GFP was also expressed in the pharyngeal marginal cells, body muscle, intestine, vulva muscles, and spermathecae.

• Primary Identifier: Expr8951
• Remark: Picture: Fig. S1. The specificity of the antiserum in whole-mount worms was confirmed as the staining pattern of egl-4(n479) null animals was indistinguishable from that of the preimmune serum's staining of wild-type animals.
• Subcellular Localization: An odor-dependent accumulation of endogenous EGL-4 within the AWC nuclei was observed.

• Primary Identifier: Expr2382
• Pattern: GFP was predominantly expressed in head neurons, a few cells in the tail and hypodermis except for seam cells. A total of 30-50 fluorescent neurons of varying intensities were observed in the head. Stronger or more consistent expression was observed in RMDV, RMD, SMDV, RIB, ASK and probably RMDD and SMDD neurons. Expression in AWC, ASE, AVJ and ASH was sometimes seen. In the tail, DVB and DVC neurons were probably expressing. GFP was also expressed in ventral cord neurons and intestine, typically near the tail. L2 and L3 larvae show extensive expression most notably in head neurons and hypodermis, and the expression is weaker in L4 and adults. Expression is also seen in later embryos.

• Primary Identifier: Expr11188
• Subcellular Localization: GFP::EGL-4 was distributed throughout ASH in wild-type animals, with expression seen in both the cytoplasm and the nucleus.

• Primary Identifier: Expr8952
• Remark: Picture: Fig. 1.
• Subcellular Localization: EGL-4GFP was evenly distributed throughout the cytoplasm of the AWC but was predominantly nuclear in the AWA and AWBs of nave animals. Eighty minutes of exposure to dilute benzaldehyde (0.01%) resulted in nuclear accumulation of GFPEGL-4 within the AWCs. Thus, prolonged exposure to an AWC-sensed odor led to nuclear accumulation of GFPEGL-4.

• Primary Identifier: Expr2383
• Pattern: GFP was expressed in body wall muscles.

• Primary Identifier: Expr11945
• Pattern: The egl-4.a::gfp construct is expressed in several head neurons (IL1 sensory neurons, SMD, and RMD motor/interneurons, and two unidentified neurons), and occasional weak expression is observed in six ventral cord motor neurons (possibly VC neurons) from the late embryonic stage through the adult stage. With another reporter, (egl-4.a::gfp::egl.4-a), additional faint expression was observed in several unidentified neurons including amphid sensory neurons.

• Primary Identifier: Expr2011227
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1152229
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1012811
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr16226
• Subcellular Localization: In wildtype animals, EGL- 4 is localized constitutively to the nucleus of the AWB neurons.

• Primary Identifier: Chronogram488
• Remark: Original chronogram file: chronogram.1497.xml
• Reporter Gene: [F55A8.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2029463
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr807
• Remark: This expression pattern is referred as the pattern cgk-1C in the article. Cosmid number and sequence of cgk-1C was not given in the article but deduced by curators.
• Pattern: a 3.0kb transcript expressed at all stages of the development. a small increase in the expression of total cgk-1 transcripts is seen in adult stage nematodes.

• Primary Identifier: Expr11523
• Pattern: Endogenous nuclear EGL-4 was detected in the nucleus of uterine epithelial cells.

79 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001173
• Start: 1848071
• End: 1880596
• Strand: 1

79 Ontology Annotations

1 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Top 10 differentially expressed genes with expression repressed in egl-4(gf) and activated in egl-4(lf) animals.	Data was analyzed using the R statistical environment. CEL files resulting from array analysis were interpreted and normalized using RMA. The linear modeling package Limma was used to determine significant gene expression differences based on a moderated t-statistic.	WBPaper00038421:egl-4(lf)_upregulated

1 Sequence

• Length: 32526

1 Sequence Ontology Term

• Name: gene

13 Strains

• WBStrain00026828
• WBStrain00026779
• WBStrain00026778
• WBStrain00026780
• WBStrain00031820
• WBStrain00051005
• WBStrain00007514
• WBStrain00007513
• WBStrain00007512
• WBStrain00005499
• WBStrain00005476
• WBStrain00005594
• WBStrain00005593

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_1847962..1848070
• Length (nt): 109
• Chromosome Location: IV: 1847962-1848070
• Organism: Caenorhabditis elegans