WormMine: Gene WBGene00001400

• WormBase Gene ID: WBGene00001400
• Gene Name: fax-1
• Sequence Name: F56E3.4
• Brief Description: fax-1 encodes a conserved nuclear receptor that contains two C4-type zinc fingers and is orthologous to the vertebrate photoreceptor-specific nuclear receptor PNR (OMIM:604485, mutated in enhanced S-cone syndrome and retinitis pigmentosa); fax-1 is required for normal locomotion and neuron fate specification, including specification of the AVA, AVE, and AVK interneurons and proper axon pathfinding of the AVK, HSNL, and PVQL axons; expression of reporter gene fusions in fax-1 mutants suggests that fax-1 functions by regulating expression of a number of downstream targets, including nmr-1 and nmr-2, opt-3, flp-1, and ncs-1; in some neurons, fax-1 regulates expression combinatorially with unc-42, which encodes a paired-like homeodomain protein that additionally, regulates fax-1 expression in AVK neurons; FAX-1 exhibits sequence-specific DNA binding in vitro and the FAX-1 DNA binding domain, when fused to the GAL4 transcriptional activator, can positively regulate transcription in yeast one-hybrid assays; FAX-1 is expressed in the nuclei of 18 neurons, including the AVK, AVA, AVB, and AVE interneurons, beginning at mid-embryogenesis and continuing through larval and adult stages; FAX-1 is also seen in two non-neuronal cell types: the distal tip cells (DTCs), from L2 to L4 larval stages, and two pairs of vulval cells in L4 animals.
• Organism: Caenorhabditis elegans
• Automated Description: Enables DNA-binding transcription factor activity, RNA polymerase II-specific and sequence-specific DNA binding activity. Involved in several processes, including neuron differentiation; positive regulation of transcription by RNA polymerase II; and regulation of locomotion. Located in nucleus. Expressed in several structures, including CEP; hermaphrodite distal tip cell; interneuron; pharyngeal motor neurons; and rect_D. Human ortholog(s) of this gene implicated in enhanced S-cone syndrome and retinitis pigmentosa 37. Is an ortholog of human NR2E3 (nuclear receptor subfamily 2 group E member 3).
• Biotype: SO:0001217
• Genetic Position: X :-10.7537 ±0.119879
• Length (nt): 3286

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001400

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F56E3.4b.1	F56E3.4b.1	1476	X: 3196064-3199349
Transcript:F56E3.4a.1	F56E3.4a.1	1376	X: 3197283-3199321

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F56E3.4a	F56E3.4a	1260	X: 3197367-3197831
CDS:F56E3.4b	F56E3.4b	1173	X: 3196307-3196512

6 RNAi Result

• WBRNAi00048731
• WBRNAi00048732
• WBRNAi00015835
• WBRNAi00015837
• WBRNAi00027911
• WBRNAi00115862

57 Allele

• gk963725
• gk776729
• gk889216
• gk573038
• gk275271
• gk275270
• gk275269
• gk955401
• gk488354
• gk421534
• gk579606
• WBVar02026892
• WBVar00076967
• WBVar01822427
• WBVar01822426
• gk275272
• gk401897
• gk539778
• gk405234
• gk769340
• gk275268
• gk587079
• gk275267
• gk873262
• gk766813
• gk745021
• ok624
• gk889503
• gk806240
• gk618018

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001400
• Start: 3196064
• End: 3199349
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_3194094..3196063
• Length (nt): 1970
• Chromosome Location: X: 3194094-3196063
• Organism: Caenorhabditis elegans

110 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Single-cell RNA-Seq cell group 71_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:71_0
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_18
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L1-larva_expressed
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L1-larva_expressed
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in animals fed with JM103 bacteria producing Cry5B, comparing to control animals fed with JM103.	ANOVA, p-value < 0.05.	WBPaper00056167:Cry5B_upregulated
	Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:spr-1(ok2144)_upregulated
	Transcripts that showed significantly increased exression in animals exposed to 100uM cadmium for 24 hours.	DESeq2 v1.20.0, fold change > 2, FDR < 0.05.	WBPaper00065029:cadmium_upregulated

12 Expression Patterns

• Primary Identifier: Expr1030838
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6227
• Remark: Strain: BC12517
• Reporter Gene: [fax-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGATTTCGACGCAATTTTTGAT] 3' and primer B 5' [ATATCAGCCAACGCAGACG] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons

• Primary Identifier: Expr6226
• Remark: Strain: BC10541
• Reporter Gene: [fax-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGATTTCGACGCAATTTTTGAT] 3' and primer B 5' [ATATCAGCCAACGCAGACG] 3'.
• Pattern: Adult Expression: intestine - . cells; Nervous System; head neurons; Larval Expression: Nervous System; head neurons; tail neurons

• Primary Identifier: Expr963
• Pattern: Transgenic animals bearing pFX1G1 had high levels of GFP fluorescence or immunoreactivity in embryonic and postembryonic neurons. fax-1::gfp expression was first detected in embryos prior to elongation (approximately 350 minutes of development). By approximately 400 minutes, there is strong fax-1::gfp expression in as many as 20 neurons in the embryonic head and 1-2 neurons in the embryonic tail. fax-1::gfp is expressed in 20 neurons postembryonically, through the adult stage. The position of these neurons indicates that most or all of them are among the 22 neurons that express fax-1::gfp embryonically. These cells include both AVKR and AVKL. fax-1::gfp was not observed in either of the HSN or PVQ neurons, or in the PVPR neuron at any stage of development. fax-1::gfp expression was observed in several other neurons and two non-neuronal cell types in transgenic animals carrying pFX1G1. These include the pairs of CEPD and URX sensory neurons, three pharyngeal neurons (M1, MI and probably M5), two pairs of ring interneurons (including the RIC pair), five neurons in the retrovesicular ganglion (including SABD and the pair of SABV neurons), a single neuron in the preanal ganglion (either PVPL or PVT) and a single neuron in the dorsorectal ganglion of the tail (probably DVA). There is incompletely penetrant fax-1::gfp expression in a few additional neurons that were not identified, and in the non neuronal dorsal rectal cell and distal tip cells of the somatic gonad.
• Subcellular Localization: GFP immunoreactivity was present in the cytoplasm, axons and nuclei of cells. Axons of neurons that express fax-1::gfp embryonically were observed in the process of outgrowth.

• Primary Identifier: Expr7586
• Remark: Clone: pUL#JRH/AC1
• Pattern: Expression is seen in head nerve cells, from late embryo to adult weakening through the life-cycle. Strong expression is seen in 2 cells and weaker expression is seen in perhaps 6 more.

• Primary Identifier: Expr3762
• Remark: In contrast to the findings of fax-1::gfp expression analysis, no accumulation of FAX-1 protein was observed in neurons of the retro-vesicular ganglion of the head or preanal ganglion of the tail, the CEP sensory neurons, or the dorsal rectal cell. Either the gfp analysis yielded these cells as false positives due to transgenic artifacts, or the gfp reporter analysis was more sensitive than anti-FAX-1 antibody. The alternative explanation that the anti-FAX-1 antibody only detects some isoforms of FAX-1 is unlikely because cDNA analysis has revealed no evidence of alternative splicing outside of the unconserved N-terminus and because the antibodies we used were polyclonal and raised to the entire known FAX-1 protein.
• Pattern: FAX-1 protein was detected in the nuclei of wild-type embryonic neurons beginning at mid-embryogenesis (approximately 350 min), the time at which most embryonic neurons differentiate, and through all larval and adult stages. For most neurons, the expression pattern was static throughout larval and adult stages. The pattern, location, and number of neurons that expressed FAX-1 in the embryo were also consistent with the postembryonic expression. This analysis confirmed the strong expression of FAX-1 in the nuclei of AVK interneurons previously reported using different methods. In addition, FAX-1 protein accumulated to high levels in the nuclei of AVA, AVB, and AVE bilateral interneuron pairs of the head. Strong FAX-1 expression was also identified in the RIC bilaterally-paired interneurons. FAX-1 was strongly expressed in two additional bilateral neuron pairs located just ventral to the AVA/AVE neurons. These neurons are SIBD and either SIBV or SMBV. Strong expression of FAX-1 protein was observed in the M4 motorneuron of the pharynx. Weak and variable FAX-1 expression was observed in the AIY interneuron pair of young larva, but no expression in adults. The only other neuron that accumulated FAX-1 was the unpaired DVA interneuron of the tail. FAX-1 protein was not observed at any stage in any of the 69 ventral midline motorneurons that mediate body movements. FAX-1 protein expressed in a dynamic fashion in the nuclei of two non-neuronal cell types during larval development. FAX-1 protein was detected in the paired distal tip cells (DTCs) of the hermaphrodite somatic gonad of L2 through L4 stage larvae and two pairs of vulval cells in L4 hermaphrodite larvae. During the time of FAX-1 expression, both of these cell types are undergoing either long range migration (DTCs) or complex local morphogenesis (vulval cells).
• Subcellular Localization: Expressed in the nuclei.

• Primary Identifier: Expr1200029
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr2011442
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1152484
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2029680
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram844
• Remark: Original chronogram file: chronogram.1886.xml
• Reporter Gene: [F56E3.4:gfp] transcriptional fusion.

• Primary Identifier: Expr1026913
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

30 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001400
• Start: 3196064
• End: 3199349
• Strand: -1

30 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3286

1 Sequence Ontology Term

• Name: gene

6 Strains

• WBStrain00027632
• WBStrain00027630
• WBStrain00028736
• WBStrain00028744
• WBStrain00031525
• WBStrain00001394

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_3199350..3200687
• Length (nt): 1338
• Chromosome Location: X: 3199350-3200687
• Organism: Caenorhabditis elegans