WormMine: Gene WBGene00001330

• WormBase Gene ID: WBGene00001330
• Gene Name: eps-8
• Sequence Name: Y57G11C.24
• Brief Description: eps-8 is encodes a cell signaling adaptor protein that contains and N-terminal PTB domain, and C-terminal SH3 and actin-binding domains; EPS-8 is essential for epidermal and intestinal cells morphogenesis; eps-8 is also involved in trafficking of the LET-23 EGF receptor during vulval development; EPS-8 physically interacts with the ankyrin repeat protein VAB-19 and demonstrates a novel actin barbed-end-capping activity; EPS-8 is expressed throughout development and localizes to sites of cell-matrix attachment and to the apical side of polarized cells.
• Organism: Caenorhabditis elegans
• Automated Description: Enables actin filament binding activity. Involved in several processes, including anatomical structure morphogenesis; barbed-end actin filament capping; and supramolecular fiber organization. Located in apical part of cell; brush border; and hemidesmosome. Expressed in several structures, including P3.pa; P3.pp; P5.ppp; P7.paa; and P9.p. Human ortholog(s) of this gene implicated in autosomal recessive nonsyndromic deafness 102; autosomal recessive nonsyndromic deafness 106; and hypotrichosis 5. Is an ortholog of human EPS8L1 (EPS8 signaling adaptor L1).
• Biotype: SO:0001217
• Genetic Position: IV :12.6052 ±0.00069
• Length (nt): 21170

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001330

Genomics

12 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y57G11C.24h.1	Y57G11C.24h.1	2847	IV: 14879484-14896742
Transcript:Y57G11C.24g.1	Y57G11C.24g.1	3096	IV: 14879484-14900653
Transcript:Y57G11C.24i.1	Y57G11C.24i.1	3056	IV: 14879491-14900545
Transcript:Y57G11C.24n.1	Y57G11C.24n.1	2832	IV: 14879563-14900393
Transcript:Y57G11C.24o.1	Y57G11C.24o.1	2757	IV: 14879563-14900393
Transcript:Y57G11C.24j.1	Y57G11C.24j.1	2664	IV: 14885688-14900393
Transcript:Y57G11C.24a.1	Y57G11C.24a.1	2848	IV: 14885688-14900652
Transcript:Y57G11C.24d.1	Y57G11C.24d.1	2538	IV: 14886649-14900393
Transcript:Y57G11C.24k.1	Y57G11C.24k.1	2613	IV: 14886649-14900393
Transcript:Y57G11C.24e.1	Y57G11C.24e.1	2260	IV: 14891464-14900653
Transcript:Y57G11C.24l.1	Y57G11C.24l.1	2073	IV: 14891466-14900393
Transcript:Y57G11C.24m.1	Y57G11C.24m.1	540	IV: 14897461-14900393

Other

12 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y57G11C.24g	Y57G11C.24g	2754	IV: 14879566-14879615
CDS:Y57G11C.24i	Y57G11C.24i	2829	IV: 14879566-14879615
CDS:Y57G11C.24j	Y57G11C.24j	2664	IV: 14885688-14885703
CDS:Y57G11C.24k	Y57G11C.24k	2613	IV: 14886649-14886834
CDS:Y57G11C.24e	Y57G11C.24e	1998	IV: 14891466-14891774
CDS:Y57G11C.24l	Y57G11C.24l	2073	IV: 14891466-14891774
CDS:Y57G11C.24m	Y57G11C.24m	540	IV: 14897461-14897505
CDS:Y57G11C.24a	Y57G11C.24a	2589	IV: 14885688-14885703
CDS:Y57G11C.24d	Y57G11C.24d	2538	IV: 14886649-14886834
CDS:Y57G11C.24h	Y57G11C.24h	2223	IV: 14879566-14879615
CDS:Y57G11C.24n	Y57G11C.24n	2832	IV: 14879563-14879615
CDS:Y57G11C.24o	Y57G11C.24o	2757	IV: 14879563-14879615

27 RNAi Result

• WBRNAi00095807
• WBRNAi00009401
• WBRNAi00078003
• WBRNAi00057696
• WBRNAi00026878
• WBRNAi00092124
• WBRNAi00064553
• WBRNAi00071872
• WBRNAi00106091
• WBRNAi00106109
• WBRNAi00061103
• WBRNAi00061104
• WBRNAi00061105
• WBRNAi00092106
• WBRNAi00071496
• WBRNAi00002358
• WBRNAi00037604
• WBRNAi00024294
• WBRNAi00064527
• WBRNAi00064770
• WBRNAi00111780
• WBRNAi00110580
• WBRNAi00065112
• WBRNAi00096330
• WBRNAi00096413
• WBRNAi00096496
• WBRNAi00096579

382 Allele

• otn10092
• gk964078
• gk963546
• gk963547
• gk964500
• gk962765
• gk963590
• gk963795
• gk963948
• WBVar01860059
• WBVar01860060
• gk964285
• WBVar01732830
• gk566983
• by160
• gk219008
• gk219010
• gk869085
• gk487076
• WBVar01732864
• WBVar01806346
• gk894164
• ok539
• gk761206
• jc36
• WBVar01732858
• WBVar01797667
• WBVar01821535
• WBVar01821536
• WBVar02021956

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001330
• Start: 14879484
• End: 14900653
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_14900654..14901132
• Length (nt): 479
• Chromosome Location: IV: 14900654-14901132
• Organism: Caenorhabditis elegans

212 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:sre-33-ZK1025.1_8337
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M

12 Expression Patterns

• Primary Identifier: Expr4383
• Pattern: The eps-8p::nls::gfp reporter is expressed in a variety of cell types including neurons, gut, muscle and seam cells as well as in the VPCs and their descendants. A time course analysis revealed a dynamic expression pattern of eps-8::nls:.gfp in the vulval cells. In mid-L2 larvae, eps-8p::nls::gfp is weakly expressed in all VPCs except for P3.p. Around 6 h later in early L3 larvae, before the first round of vulval cell divisions, expression is strongest in P6.p, lowest in P5.p and P7.p and intermediate in P3.p, P4.p and P8.p.

• Primary Identifier: Expr4384
• Pattern: Among the vulval cells, EPS-8 protein was detectable only in P6.p and its descendants. At later stages during vulval morphogenesis, eps-8p::nls::gfp expression and antibody staining is found in all vulval cells including the descendants of P5.p and P7.p.

• Primary Identifier: Expr1030810
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1019290
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr8388
• Remark: Picture: Figure 1B, 1C.
• Pattern: eps-8 transcriptional reporters were likewise expressed in dorsal and ventral embryonic epidermal cells beginning soon after epidermal enclosure and persisting in larval and adult stages. Peps-8-GFP was also expressed in sublateral neurons.

• Primary Identifier: Expr3207
• Pattern: Both the K49 and SI85 antibodies, and both arrays, showed that EPS-8 was expressed throughout development, from embryogenesis to adulthood. Expression in post-embryonic stages was prominent in the myoepithelial cells of the pharynx and in the intestine, where EPS-8 localized in the brush border, as it was more apical than the intermediate filaments of the terminal web.
• Subcellular Localization: Expression in post-embryonic stages was prominent in the myoepithelial cells of the pharynx and in the intestine, where EPS-8 localized in the brush border, as it was more apical than the intermediate filaments of the terminal web.

• Primary Identifier: Expr7080
• Remark: Also expressed in (comments from author) : Larval hypodermis is very low intensity. Strain: BC14883
• Reporter Gene: [eps-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCGCAACTTCTTTCTCATGG] 3' and primer B 5' [ATCCACCTCGACGGATCA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: hypodermis; Nervous System; head neurons

• Primary Identifier: Expr8389
• Remark: Picture: Figure 1D - 1G.
• Reporter Gene: To examine subcellular localization of EPS-8 within epidermal cells authors inserted GFP into the N-terminus of EPS-8 and expressed it under the control of the epidermal-specific vab-19 promoter. The eps-8 locus generates two isoforms that differ in their C-termini, as a result of alternative splicing: EPS-8A contains the C-terminal actin binding effector domain, whereas EPS-8B does not. Both EPS-8::GFP fusion proteins displayed indistinguishable patterns in the epidermis, and are referred to generically as EPS-8::GFP.
• Subcellular Localization: In post-embryonic stages EPS-8::GFP was localized to circumferential bands in epidermis adjacent to muscles, a pattern corresponding to trans-epidermal attachments. EPS-8::GFP also localized to other sites of trans-epidermal attachments. These results indicate that in epidermal cells EPS-8, like VAB-19, is localized to sites of cell-matrix attachments. In pharyngeal marginal cells, Pvab-19-EPS-8B::GFP was localized to the apical (lumenal) ends of attachment structures and not to the basal surface.

• Primary Identifier: Expr16295
• Subcellular Localization: Using CRISPR-Cas9, we inserted a fluorescent tag at the endogenous locus encoding VAB-10B, PAR-1, SMA-1, EPS-8A, and H24G06.1, an uncharacterized protein. We found that, like PTRN-1, all five proteins localized to the apical membranes of the embryonic intestine.

• Primary Identifier: Expr2011352
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1161108
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2029588
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

31 GO Annotation

15 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001330
• Start: 14879484
• End: 14900653
• Strand: 1

31 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 21170

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00031465
• WBStrain00005395
• WBStrain00003266

0 Upstream Intergenic Region