WormMine: Gene WBGene00001819

• WormBase Gene ID: WBGene00001819
• Gene Name: haf-9
• Sequence Name: ZK484.2
• Brief Description: haf-9 encodes a protein similar to the conserved half-type ATP-binding cassette (ABC) transporter, TAPL/ABCB9; in elegans, haf-9 along with another TAPL gene, haf-4 is required for the formation of intestinal organelles; haf-9 and haf-4 are required for proper growth, normal brood size and for the normal defecation cycle; haf-9 and haf-4 are localized to intestinal organelles and physically interact to form a heterodimer.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATPase-coupled transmembrane transporter activity. Involved in lysosomal transport and regulatory ncRNA-mediated post-transcriptional gene silencing. Located in lysosomal membrane. Is an ortholog of human ABCB9 (ATP binding cassette subfamily B member 9).
• Biotype: SO:0001217
• Genetic Position: I :0.774715 ±0.009006
• Length (nt): 4225

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001819

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK484.2a.2	ZK484.2a.2	2639	I: 6081782-6086006
Transcript:ZK484.2a.1	ZK484.2a.1	2577	I: 6081812-6085957
Transcript:ZK484.2b.1	ZK484.2b.1	2025	I: 6081816-6085023

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK484.2a	ZK484.2a	2448	I: 6081816-6081920
CDS:ZK484.2b	ZK484.2b	2025	I: 6081816-6081920

5 RNAi Result

• WBRNAi00002327
• WBRNAi00059446
• WBRNAi00004936
• WBRNAi00038304
• WBRNAi00078232

51 Allele

• gk962858
• gk962706
• gk963902
• gk964505
• WBVar01431812
• WBVar01431811
• WBVar01431810
• WBVar01431813
• gk964347
• gk23
• gk112327
• gk112328
• gk112329
• gk112330
• gk112323
• gk112324
• gk112325
• gk112326
• h6909
• ttTi5922
• h15540
• gk960881
• gk905212
• gk850441
• gk761355
• gk348873
• gk386023
• gk474979
• gk496375
• gk887042

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001819
• Start: 6081782
• End: 6086006
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_6086007..6087429
• Length (nt): 1423
• Chromosome Location: I: 6086007-6087429
• Organism: Caenorhabditis elegans

242 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Genes that showed increased expression in wdr-5(ok1417) comparing with in N2.	Statistical analysis for misexpression was performed using a moderated t test from the package limma. All genes with a false discovery rate (FDR) of <= 5% (p <= 0.05) were selected as differentially regulated.	WBPaper00045861:wdr-5(ok1417)_upregulated
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that were downregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_downregulated
	Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
mitochondrial sulfide delivery molecule (mtH2S) AP39	Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Photorhabdus luminescens	Genes down-regulated in animals infected with Photorhabdus luminescens compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Photorhabdus_luminescens_downregulated
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	mRNAs that showed differential expression in activated AAK-2(uthIs202[aak-2 (intron 1)::aak-2(aa1-aa321)::Tomato::unc-54 3'UTR + rol-6(su1006)]), activiated CRTC-1 (uthEx222[crtc-1p::crtc-1 cDNA (S76S, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]), or AAK-2;CRTC-1 comparing to in N2.	Genes were tested for differential expression between each mutant strain and wild-type using edgeRs glm method. Briefly, negative binomial models were fitted and dispersion estimates obtained. These were then used to calculate average levels of change between conditions and determine differential expression, using the generalized linear model likelihood ratio test. For each comparison, genes with less than 5 CPM were filtered and those with at least 50% change and False Discovery Rate (FDR) of 1% or less were considered differentially expressed.	WBPaper00046499:AMPK_regulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs

10 Expression Patterns

• Primary Identifier: Expr1031067
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1162872
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr7218
• Remark: Strain: BC10024
• Reporter Gene: [haf-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTGGGAATCGATGAGAAAACG] 3' and primer B 5' [gaactcagtcttctgaaaatctcg] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Larval Expression: intestine; rectal gland cells

• Primary Identifier: Expr8981
• Remark: Picture: Fig 2, Fig 3, Fig S2A.
• Pattern: GFP expression was observed at the larval and adult stages exclusively in all of the 20 intestinal cells of which a whole intestine consists. At the embryonic stage, no expression was found.
• Subcellular Localization: Double labeling of intestinal cells with acridine orange, a dye for acidic compartment staining. As a result, HAF-4::GFP-positive and acridine orange-positive granules turned out to be mutually exclusive, and the pattern was same in case of HAF-9:: GFP-positive granules. A similar exclusive pattern was observed when LysoTracker Red, another dye for monitoring the acidification of subcellular compartments, was used in place of acridine orange. In intestinal cells of the late larval and adult stages, HAF-4::GFP and HAF-9::GFP seemed, under confocal microscopy, to be distributed on the surface of intestinal granules of some sort. These results indicate that HAF-4 and HAF-9 are present on the membranes of some intestinal granules. The HAF-4::GFP-positive and HAF-9::GFP-positive granules were relatively large (>2 um average diameter) and accounted for the majority of distinguishable intestinal granules.

• Primary Identifier: Expr8983
• Remark: Picture: Fig S1.
• Subcellular Localization: Western blot analysis using polyclonal antiserum against the recombinant HAF-9 protein and anti-GFP antibody revealed that both GFP-tagged and endogenous proteins were enriched in the membrane fraction.

• Primary Identifier: Expr3348
• Pattern: Expressed strongly in gut, 4 isolates.

• Primary Identifier: Expr2030597
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1653
• Remark: Original chronogram file: chronogram.535.xml
• Reporter Gene: [ZK484.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2012361
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018233
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

20 GO Annotation

12 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001819
• Start: 6081782
• End: 6086006
• Strand: 1

20 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4225

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00035492

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_6078897..6081781
• Length (nt): 2885
• Chromosome Location: I: 6078897-6081781
• Organism: Caenorhabditis elegans