WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00001918 Gene Name  his-44
Sequence Name  ? F08G2.1 Brief Description  his-44 encodes an H2B histone.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be a structural constituent of chromatin. Involved in innate immune response. Predicted to be part of nucleosome. Is an ortholog of several human genes including H2BC12 (H2B clustered histone 12); H2BC17 (H2B clustered histone 17); and H2BC3 (H2B clustered histone 3).
Biotype  SO:0001217 Genetic Position  II :20.3298±
Length (nt)  ? 369
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00001918

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F08G2.1.1 F08G2.1.1 369   II: 13826730-13827098
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F08G2.1 F08G2.1 369   II: 13826730-13827098

17 RNAi Result

WormBase ID
WBRNAi00095560
WBRNAi00094012
WBRNAi00094226
WBRNAi00090827
WBRNAi00082054
WBRNAi00044043
WBRNAi00044044
WBRNAi00044045
WBRNAi00082059
WBRNAi00061070
WBRNAi00061071
WBRNAi00061072
WBRNAi00061073
WBRNAi00103655
WBRNAi00025035
WBRNAi00027052
WBRNAi00027055

4 Allele

Public Name
gk963801
gk963053
gk962684
gk962539

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00001918 13826730 13827098 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_13825844..13826729   886 II: 13825844-13826729 Caenorhabditis elegans

76 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  oocyte proteins identified by two or more unique peptides during proteomics study. In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. WBPaper00038289:oocyte_protein
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C. DESeq2, fold change > 2, p-value < 0.05. WBPaper00061753:csr-1(tor159)_upregulated_25C
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
  Transcripts that showed signifcantly increased expression in pabp-2(RNAi) animals comparing to in N2 animals injected with empty vector at L1 larva stage and collected at L4 larva stage. FDR < 0.05, fold change > 2 WBPaper00067368:pabp-2(RNAi)_upregulated_N2
  Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage. DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed. WBPaper00048971:daf-16(mgDf50)_downregulated_L1
  Transcripts that showed significantly increased expression in hda-1[KKRR] in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4747)_upregulated
Bacteria infection: Staphylococcus aureus mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus. DESeq, p <= 0.05 WBPaper00045314:S.aureus-induced_N2
  Transcripts that showed significantly increased expression in flr-1(RNAi) comparing to in control RNAi animals. This is an incomplete list. N.A. WBPaper00055060:flr-1(RNAi)_downregulated
  Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals. Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed. WBPaper00062193:skn-1(RNAi)_upregulated
  Transcripts that showed significantly increased expression in hira-1(gk835598) comparing to in N2 animals at L4 larva stage. Differential expression analysis was done with Rversion 2.15.3 using DESeq_1.10.1. Fold change > 2, p-value < 0.01. WBPaper00059739:hira-1(gk835598)_upregulated_L4
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts of coding genes that showed significantly increased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_enriched_coding-RNA
  Transcripts that showed significantly increased expression in hsf-1(sy441) after worms were heat shocked at 35C for 30 minutes followed with a 1-hour long recovery at 20C, comparing to N2 animals with the same treatment. edgeR, fold change > 2, FDR < 0.05 WBPaper00066900:hsf-1(sy441)_upregulated_heat-shock
  Transcripts that showed significantly increased expression in him-17(me24) comparing to in N2 animals. DESeq2, fold change > 2, FDR < 0.05. WBPaper00064769:him-17(me24)_upregulated
  Transcripts that showed significantly increased expression in sams-3(RNAi) comparing to N2 animals injected with empty vector. Deseq FDR < 0.01, fold change > 2. WBPaper00065005:sams-3(RNAi)_upregulated
  Transcripts that showed significantly increased expression in sams-4(RNAi) comparing to N2 animals injected with empty vector. Deseq FDR < 0.01, fold change > 2. WBPaper00065005:sams-4(RNAi)_upregulated
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Differentially-expressed genes in the MA lines.   WBPaper00025099:MA_specific
  Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C. N.A. WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
  Transcripts that showed significantly increased expression in pals-22(jy3) comparing to in N2 at L4 larva stage. Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used. WBPaper00056034:pals-22(jy3)_upregulated
  Transcripts that showed significantly increased expression in pals-22(jy3)pals-25(jy9) comparing to in pals-22(jy3) at L4 larva stage. Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used. WBPaper00056034:pals-25(jy9)_upregulated
  Transcripts that showed significantly decreased expression in fmi-1(rh308) young adults comparing to in N2 animals. fold change > 2, p-value < 0.05 WBPaper00066618:fmi-1(rh308)_downregulated
  Transcripts that interact with 3xFLAG-DLC-1 as identified by immunoprecipitation followed by RNA sequencing. DESeq2, fold change > 2,, p-value < 0.01 WBPaper00055334:DLC-1_interacting
Wounding: 2 hours after a single stab of a microinjection needle to either anterior or posterior body of lateral hyp7 (avoid the gonad) 24 hr after the L4 stage. Transcripts that showed significantly increased expression 2 hours after animals had a single stab of a microinjection needle to either anterior or posterior body of lateral hyp7 (avoid the gonad) 24 hr after the L4 stage. The cutoff for differential expressed genes (DEGs) were: Benjamini-Hochberg adjustedP-valueless than 0.05 and fold change larger than 1.5. WBPaper00059987:Wounding_upregulated
  Transcripts that showed significantly increased expression in nhl-2(ok818) comparing to in N2 at 25C. EdgeR, FDR < 0.05, fold change < 0.5. WBPaper00055971:nhl-2(ok818)_25C_downregulated
  Transcripts that showed significantly decreased expression in flcn-1(ok975) comparing to in N2. Student's t-test. WBPaper00056471:flcn-1(ok975)_downregulated
  Transcripts that showed significantly decreased expression in lin-22(icb38) comparing to in N2 at L3 larva. Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1). WBPaper00053295:lin-22(icb38)_downregulated

4 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. Strain: BC12120 [his-44::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATCTCAAAATCTAACCGAACCC] 3' and primer B 5' [ATGTTGAGAGTTGGTGACTTGAAA] 3'. Expr5690 Adult Expression: intestine; Larval Expression: intestine; hypodermis; seam cells;  
    Expr1027242 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1148009 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2030697 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

5 GO Annotation

Annotation Extension Qualifier
  involved_in
  part_of
  enables
  enables
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00001918 13826730 13827098 -1

5 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  part_of
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
369

1 Sequence Ontology Term

Identifier Name Description
gene  

7 Strains

WormBase ID
WBStrain00062943
WBStrain00062935
WBStrain00062936
WBStrain00062934
WBStrain00062894
WBStrain00062891
WBStrain00062892

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_13827099..13827325   227 II: 13827099-13827325 Caenorhabditis elegans