WormMine: Gene WBGene00002026

• WormBase Gene ID: WBGene00002026
• Gene Name: hsp-70
• Sequence Name: C12C8.1
• Brief Description: hsp-70 encodes a heat-shock protein that is a member of the hsp70 family of molecular chaperones.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATP hydrolysis activity; heat shock protein binding activity; and protein folding chaperone. Involved in determination of adult lifespan and response to heat. Part of chaperonin-containing T-complex. Is an ortholog of human HSPA6 (heat shock protein family A (Hsp70) member 6) and HSPA7 (heat shock protein family A (Hsp70) member 7 (pseudogene)).
• Biotype: SO:0001217
• Genetic Position: I :3.74266 ±0.00151
• Length (nt): 2195

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002026

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C12C8.1.1	C12C8.1.1	2057	I: 9320325-9322519

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C12C8.1	C12C8.1	1932	I: 9320412-9321269

19 RNAi Result

• WBRNAi00007506
• WBRNAi00040370
• WBRNAi00040372
• WBRNAi00106314
• WBRNAi00002945
• WBRNAi00082883
• WBRNAi00097041
• WBRNAi00076113
• WBRNAi00082881
• WBRNAi00028815
• WBRNAi00031480
• WBRNAi00082500
• WBRNAi00062702
• WBRNAi00082610
• WBRNAi00063658
• WBRNAi00113322
• WBRNAi00092915
• WBRNAi00070101
• WBRNAi00065459

29 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• gk964316
• WBVar01432513
• WBVar01432511
• WBVar01432512
• gk735680
• gk361768
• gk491889
• gk477750
• gk529585
• gk118532
• ttTi13882
• gk875862
• WBVar01902432
• gk118533
• gk334488
• gk118534
• gk458050
• tm2318
• gk666914
• gk767927
• gk361364
• gk424143
• gk385327
• gk434067
• WBVar01849694

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002026
• Start: 9320325
• End: 9322519
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

355 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that were downregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_downregulated
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite N2 animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_N2
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts that showed significantly increased expression after 24 hours of induction of human beta Amyloid at young adult stage	A 2-fold change in expression level and a false discovery rate analog of p < 0.05.	WBPaper00064130:Beta-Amyloid_24h_upregulated_mRNA
	Transcripts that showed significantly decreased expression in vit-2(ac3); zcIs4, comparing to parenting strain SJ4005 [zcIs4].	Differential gene expression analysis was then performed on normalized samples. Genes exhibiting at least twofold change and a false-discovery rate (FDR) of 1% or less were considered differentially expressed.	WBPaper00051305:vit-2(ac3)_downregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in wdr-5(ok1417);skn-1(lax188) comparing to in skn-1(lax188) at day 2 adult stage.	fold change > 2	WBPaper00058711:wdr-5(ok1417)_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370;mes-1(bn84ts) comparing to in mes-1(bn84ts).	DESeq2 was used for differential expression analysis. A BenjaminiHochberg multiple hypothesis-corrected P-value cutoff of 0.05 was used as a significance cutoff.	WBPaper00049368:daf-2(e1370)_upregulated

7 Expression Patterns

• Primary Identifier: Expr5244
• Remark: Strain: BC10060
• Reporter Gene: [hsp-70::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCCATTTCTTAAATGCAG] 3' and primer B 5' [atttcagcgtttgaatagca] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Larval Expression: stomato-intestinal muscle; anal depressor muscle

• Primary Identifier: Expr1031181
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2012630
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1026291
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1144434
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2030866
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram2013
• Remark: Original chronogram file: chronogram.925.xml
• Reporter Gene: [C12C8.1:gfp] transcriptional fusion.

18 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002026
• Start: 9320325
• End: 9322519
• Strand: -1

18 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2195

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00001144

0 Upstream Intergenic Region