WormMine: Gene WBGene00002010

• WormBase Gene ID: WBGene00002010
• Gene Name: hsp-6
• Sequence Name: C37H5.8
• Brief Description: hsp-6 encodes a nuclear-encoded mitochondrion-specific chaperone that is a member of the DnaK/Hsp70 superfamily of molecular chaperones; hsp-6 is involved in the mitochondrial unfolded protein response, as hsp-6 expression, normally broadly detected from the L1 larval through adult stages of development, is greatly increased in response to treatments that disrupt mitochondrial protein handling; loss of hsp-6 activity via RNAi results in severe growth defects with arrest at embryonic and early larval stages of development; loss of hsp-6 via RNAi in young adult hermaphrodites results in abnormal mitochondrial membrane potential and morphology, accompanied by reduction of ATP levels and reduced levels of mitochondrial proteins ATP-2, HSP-60, and CLK-1; in addition, hsp-6(RNAi) of adults disrupts gonadal function, motility, and pharyngeal pumping, as well as resulting in reduced lifespan; an HSP-6::GFP fusion protein localizes to mitochondria; HSP-6 levels are markedly reduced in aged worms.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATP hydrolysis activity; heat shock protein binding activity; and protein folding chaperone. Involved in mitochondrial unfolded protein response. Located in mitochondrion. Expressed in muscle cell. Human ortholog(s) of this gene implicated in Alzheimer's disease; Parkinson's disease; autosomal dominant sideroblastic anemia 4; and rheumatoid arthritis. Is an ortholog of human HSPA9 (heat shock protein family A (Hsp70) member 9).
• Biotype: SO:0001217
• Genetic Position: V :-4.17034 ±0.014856
• Length (nt): 2637

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002010

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C37H5.8.1	C37H5.8.1	2460	V: 4824124-4826760

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C37H5.8	C37H5.8	1974	V: 4824605-4825008

59 RNAi Result

• WBRNAi00095519
• WBRNAi00096789
• WBRNAi00066460
• WBRNAi00113925
• WBRNAi00066701
• WBRNAi00113922
• WBRNAi00084609
• WBRNAi00084608
• WBRNAi00064957
• WBRNAi00090971
• WBRNAi00076204
• WBRNAi00093590
• WBRNAi00093441
• WBRNAi00093442
• WBRNAi00093443
• WBRNAi00093444
• WBRNAi00093440
• WBRNAi00093445
• WBRNAi00093446
• WBRNAi00080979
• WBRNAi00024775
• WBRNAi00084197
• WBRNAi00033287
• WBRNAi00106313
• WBRNAi00008500
• WBRNAi00042129
• WBRNAi00066458
• WBRNAi00106629
• WBRNAi00113845
• WBRNAi00066459

40 Allele

• gk963301
• gk963591
• gk963553
• gk964259
• gk964351
• gk963850
• WBVar01861634
• tm515
• gk710042
• gk467790
• gk415739
• gk757610
• gk864106
• gk462082
• gk474349
• gk442296
• gk460017
• gk668428
• gk900653
• gk554774
• gk829019
• gk354452
• gk734431
• WBVar01650904
• WBVar02023594
• gk948232
• gk233801
• gk233799
• gk233800
• gk233797

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002010
• Start: 4824124
• End: 4826760
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_4823424..4824123
• Length (nt): 700
• Chromosome Location: V: 4823424-4824123
• Organism: Caenorhabditis elegans

211 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_upregulated
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Transcripts that showed significantly increased expression in clk-1(qm30) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:clk-1(qm30)_upregulated
	Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:isp-1(qm150)_upregulated

12 Expression Patterns

• Primary Identifier: Expr4640
• Subcellular Localization: Most of the GFP fluorescence was observed with Mito-Tracker-positive structures, clearly indicating localization of the fusion protein to mitochondria. Similar mitochondrial localization was observed using the 38-amino acid residue of HSP-6 that was predicted to contain a mitochondrial targeting signal.

• Primary Identifier: Expr4641
• Remark: HSP-1 (hsp70A), which is most similar to HSP-6 (61%) and is localized in the cytoplasm, and actin were mostly recovered in the postmitochondrial supernatant and not in the mitochondrial fraction confirming the efficient removal of cytoplasm from the mitochondrial fraction. Type: Differential centrifugation. Worms were homogenized, and a mitochondria-enriched fraction was prepared by differential centrifugation.
• Subcellular Localization: HSP-6 was clearly co-purified together with mitochondrial markers (HSP-60, a mitochondrial chaperone; ATP-2, the beta-subunit of F1-ATPase; CLK-1, a subunit of ubiquinone synthetase), indicating the localization of HSP-6 in mitochondria.

• Primary Identifier: Expr5467
• Remark: Strain: BC10064
• Reporter Gene: [hsp-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATTTTAACACCTCGTAAAAT] 3' and primer B 5' [cctgaaagaaaattgcatca] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr1031173
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1871
• Remark: The amount of hsp70F in the transgenic line carrying pPD70f increased two- to three-fold relative to the wild-type animals. The expression pattern of hsp70F in transgenic lines carrying pPD70f were almost the same as that of the expression of GFP in transgenic line carrying pPD91.14. hsp70F = hsp-6 --[cgc1136].
• Pattern: The expression of hsp70F as detected by immunohistochemical staining with the anti-hsp70F anti-serum shows tissue specific expression of hsp70F in the muscle cells of the C. elegans including body walls and anus muscle.

• Primary Identifier: Expr13432
• Pattern: Expression of hsp-6 was broad and most clearly visible in the intestine. Strong expression of hsp-6 or an accumulation of the reporter led to bright staining of a posterior segment of the intestine.

• Primary Identifier: Expr2012629
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1146130
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr3096
• Pattern: GFP was expressed broadly in multiple transgenic lines and expression was noted from L1 larva to adults.

• Primary Identifier: Expr2030865
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1015620
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1656
• Remark: Original chronogram file: chronogram.539.xml
• Reporter Gene: [C37H5.8:gfp] transcriptional fusion.

18 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002010
• Start: 4824124
• End: 4826760
• Strand: -1

18 Ontology Annotations

4 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
	Transcripts that showed significantly increased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_upregulated
	Significantly differentially expressed genes in hsp-6 RNAi versus Empty Vector (FDR <= 0.05 and fold-change greater than 2).	FDR <= 0.05 and fold-change greater than 2.	WBPaper00050407:hsp-6(RNAi)_downregulated
	Significantly differentially expressed genes in hsp-6 RNAi versus Empty Vector (FDR <= 0.05 and fold-change greater than 2).	FDR <= 0.05 and fold-change greater than 2.	WBPaper00050407:hsp-6(RNAi)_upregulated

1 Sequence

• Length: 2637

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00034068
• WBStrain00051701
• WBStrain00001148
• WBStrain00007968

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_4826761..4826992
• Length (nt): 232
• Chromosome Location: V: 4826761-4826992
• Organism: Caenorhabditis elegans