WormMine: Gene WBGene00002827

• WormBase Gene ID: WBGene00002827
• Gene Name: let-653
• Sequence Name: C29E6.1
• Brief Description: let-653 encodes a mucin-like protein similar to the highly glycosylated mucins secreted by the apical surface of epithelia and believed to provide a protective barrier to exposed cellular surfaces; LET-653 is required for viability, locomotion, and for maintaining the tubular epithelial structure of the excretory cell canals.
• Organism: Caenorhabditis elegans
• Automated Description: A structural constituent of cuticle. Involved in several processes, including cuticle pattern formation; embryonic ectodermal digestive tract morphogenesis; and regulation of developmental process. Located in apical plasma membrane; extracellular space; and supramolecular fiber. Expressed in excretory duct cell; excretory socket cell; rectal epithelial cell; and vulval cell.
• Biotype: SO:0001217
• Genetic Position: IV :5.36564 ±0.003548
• Length (nt): 5470

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002827

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C29E6.1b.1	C29E6.1b.1	2157	IV: 11885613-11891082
Transcript:C29E6.1a.1	C29E6.1a.1	2631	IV: 11885615-11891081
Transcript:C29E6.1c.1	C29E6.1c.1	2082	IV: 11885618-11890892

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C29E6.1a	C29E6.1a	2439	IV: 11885618-11885678
CDS:C29E6.1c	C29E6.1c	2082	IV: 11885618-11885678
CDS:C29E6.1b	C29E6.1b	1962	IV: 11885618-11885678

18 RNAi Result

• WBRNAi00070332
• WBRNAi00041455
• WBRNAi00024670
• WBRNAi00008461
• WBRNAi00064603
• WBRNAi00064834
• WBRNAi00030263
• WBRNAi00068443
• WBRNAi00068444
• WBRNAi00068445
• WBRNAi00068446
• WBRNAi00068447
• WBRNAi00064487
• WBRNAi00068903
• WBRNAi00070330
• WBRNAi00070329
• WBRNAi00070331
• WBRNAi00114316

89 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• gk962528
• s1733
• s2270
• s2377
• h16684
• gk676572
• gk213577
• gk366847
• gk627709
• gk213575
• gk538568
• gk213576
• gk768666
• gk213573
• gk816296
• gk213574
• gk430715
• gk213571
• gk665061
• gk213572
• gk521127
• gk882605
• gk837606
• gk432221
• gk594487
• gk730284

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002827
• Start: 11885613
• End: 11891082
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_11891083..11899288
• Length (nt): 8206
• Chromosome Location: IV: 11891083-11899288
• Organism: Caenorhabditis elegans

252 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly decreased expression in adbp-1(qj1) comparing to in N2 animals at L4 larva stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067079:adbp-1(qj1)_downregulated_L4
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Bacteria diet: Comamonas aquatica DA1887 vs. E. coli OP50	Transcripts that showed significantly decreased expression in N2 L3 larva animals fed with Comamonas aquatica strain DA1887, comparing to in N2 L3 larva animals fed with E. coli OP50.	edgeR, fold change > 2, p-value < 0.05.	WBPaper00067248:C.aquatica_downregulated_L3
	Transcripts that showed significantly decreased expression in skn-1gf(lax188) comparing to in N2 animals at L4 stage fed with OP50 and exposed to PA14 for 4 hours.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067255:skn-1(lax188)_downregulated_PA
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in adr-1(tm668) and adr-1(gv6) comparing to in N2 at L4 larva stage.	DESeq FDR <= 0.05	WBPaper00056617:adr-1_upregulated_L4_transcript
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed signifcantly increased expression in ubr-5(miy31) injected with empty vector comparing to in N2 animals injected with empty vector at L1 larva stage and collected at L4 larva stage.	FDR < 0.05, fold change > 2	WBPaper00067368:ubr-5(miy31)_upregulated_N2
	Transcripts that showed significantly increased expression after treatment with TPEN (2.5uM and 5uM) from L1 to L4 larva.	N.A.	WBPaper00051498:zinc-reduction_upregulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated

10 Expression Patterns

• Primary Identifier: Expr5376
• Remark: Also expressed in (comments from author) : The listed expression pattern was from June 2004. When viewed again, May 2005, there was only hypodermis in adults. Strain: BC10642
• Reporter Gene: [let-653::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTAGGTGGAGCGAAGCAA] 3' and primer B 5' [TTAGTGGATGTCGGATTTACTGAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulva other; body wall muscle; hypodermis; seam cells; Larval Expression: intestine; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; head neurons

• Primary Identifier: Expr1031364
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr13008
• Pattern: A let-653 promoter::GFP transcriptional reporter was expressed in external (cuticle-producing) epithelial cells, including the epidermis, vulva, rectum and excretory duct and pore, but was mostly excluded from internal epithelia such as the pharynx, intestine and excretory canal cell. Occasionally, let-653pro::GFP expression was observed in the canal cells of embryos, but this expression disappeared in later stages LET-653 fusion proteins were never observed in the canal cell.

• Primary Identifier: Expr13009
• Subcellular Localization: In the vulva and likely in the excretory duct and pore tubes, LET-653 localizes transiently to two distinct pre-cuticular apical extracellular matrix compartments.

• Primary Identifier: Chronogram509
• Remark: Original chronogram file: chronogram.1525.xml
• Reporter Gene: [C29E6.1:gfp] transcriptional fusion.

• Primary Identifier: Expr15950
• Pattern: LET-653 is expressed by all vulva cell types. The ZP proteins FBN-1 and LET-653 showed somewhat complementary luminal patterns. Beginning at L4.2, and as previously reported for LET-653(PAN domain) fragments (Gill et al., 2016), LET-653 decorated a core structure in the center of the lumen that rises to the level of the vulD and vulE cells, along with lateral elements that connect this core to the vulA, vulB1 and vulB2 cells and to the surrounding epidermis. The central core structure could also be detected very weakly by DIC. This core changed appearance during vulva eversion, but remained visible in the most ventral, 2 ̊-cell-derived region through the L4.9 stage. Transiently, at the L4.3-L4.5 stages, LET-653 also weakly marked the apical membranes of most cells. Finally, FBN-1 overlapped with LET-653-marked structures near vulB1 and vulB2 surfaces, but otherwise was mainly excluded from the core area and instead filled the more dorsal part of the lumen above the core. During vulva eversion, FBN-1 became excluded from the dorsal-most portions of the lumen lined by 1 ̊-derived cells, such that LET-653 and FBN-1 together appeared to demarcate at least three separate luminal zones roughly corresponding to the regions outlined by the vulA/B cells, vulC/D cells, and vulE/F cells.

• Primary Identifier: Expr2013069
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1016864
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031301
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1145484
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

21 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002827
• Start: 11885613
• End: 11891082
• Strand: 1

21 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5470

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00051077
• WBStrain00000664

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_11884135..11885612
• Length (nt): 1478
• Chromosome Location: IV: 11884135-11885612
• Organism: Caenorhabditis elegans