WormMine: Gene WBGene00003790

• WormBase Gene ID: WBGene00003790
• Gene Name: npp-4
• Sequence Name: Y54E5A.4
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable phospholipid binding activity. Predicted to be a structural constituent of nuclear pore. Involved in several processes, including determination of adult lifespan; establishment of mitotic spindle orientation; and nucleus organization. Predicted to be part of nuclear pore central transport channel.
• Biotype: SO:0001217
• Genetic Position: I :26.3395 ±0.059425
• Length (nt): 5401

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003790

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y54E5A.4.1	Y54E5A.4.1	1807	I: 14701122-14706522

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y54E5A.4	Y54E5A.4	1617	I: 14701310-14701530

12 RNAi Result

• WBRNAi00026848
• WBRNAi00094134
• WBRNAi00022489
• WBRNAi00094269
• WBRNAi00064243
• WBRNAi00071086
• WBRNAi00037476
• WBRNAi00057383
• WBRNAi00026849
• WBRNAi00078409
• WBRNAi00094505
• WBRNAi00094526

115 Allele

• gk963849
• gk964175
• gk962681
• h18054
• otn9412
• gk963947
• gk963269
• gk129815
• gk129814
• gk129816
• gk129817
• gk129804
• gk129806
• gk129805
• gk129811
• gk129810
• gk129813
• gk129812
• gk129807
• gk129809
• gk129808
• WBVar01715199
• WBVar01826487
• ok617
• WBVar01681477
• gk668109
• snx215
• gk515833
• WBVar01236029
• WBVar01574556

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003790
• Start: 14701122
• End: 14706522
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_14700393..14701121
• Length (nt): 729
• Chromosome Location: I: 14700393-14701121
• Organism: Caenorhabditis elegans

106 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Genes down-regulated following nhr-25(RNAi).	Pair-wise significance testing (mutant/RNAi vs. wild-type/vector) was performed using the Bioconductor package limma and p-values were initially corrected for multiple testing using the false discovery rate (FDR) method of Benjamini and Hochberg. Authors defined differential expression as log2(ratio) >= 0.848 with the FDR set to 5%, and p-value <= 0.001.	WBPaper00045015:nhr-25(RNAi)_downregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated

7 Expression Patterns

• Primary Identifier: Expr1031776
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr7043
• Remark: Strain: BC14807
• Reporter Gene: [npp-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCGAGTTTTGTGAGCAAT] 3' and primer B 5' [AAAAGCGAGATTTCTGGAAAATTA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Chronogram10
• Remark: Original chronogram file: chronogram.1006.xml
• Reporter Gene: [Y54E5A.4:gfp] transcriptional fusion.

• Primary Identifier: Expr2032630
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2014389
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1025832
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1160817
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

13 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003790
• Start: 14701122
• End: 14706522
• Strand: -1

13 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5401

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00035744

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_14706523..14707058
• Length (nt): 536
• Chromosome Location: I: 14706523-14707058
• Organism: Caenorhabditis elegans