WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00003770 Gene Name  nlp-32
Sequence Name  ? F30H5.2 Brief Description  nlp-32 encodes a neuropeptide-like protein.
Organism  Caenorhabditis elegans Automated Description  Predicted to be involved in neuropeptide signaling pathway. Predicted to be located in extracellular region. Expressed in head.
Biotype  SO:0001217 Genetic Position  III :-26.8347 ±0.002341
Length (nt)  ? 434
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00003770

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F30H5.2.1 F30H5.2.1 387   III: 486114-486547
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F30H5.2 F30H5.2 318   III: 486169-486346

7 RNAi Result

WormBase ID
WBRNAi00045975
WBRNAi00014124
WBRNAi00020998
WBRNAi00020999
WBRNAi00006551
WBRNAi00031603
WBRNAi00061795

14 Allele

Public Name
gk962532
gk964281
sy1459
WBVar01768662
gk164717
gk492594
gk427431
gk703930
gk451380
WBVar02030028
gk730801
gk548067
gk894567
gk628779

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00003770 486114 486547 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_485928..486113   186 III: 485928-486113 Caenorhabditis elegans

82 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage. DESeq v1.6.3. Fold change > 1.5. WBPaper00050370:dpy-21(e428)_L3_upregulated
Fungi infection: Haptoglossa zoospora. Transcripts that showed significantly altered expression after L4 N2 animals were exposed to omycete Haptoglossa zoospora for 6 hours. Kalisto abundance files were converted and analysed using Sleuth in a R pipeline. Standard Sleuth protocols were used to calculate differential expression. P value < 0.01 and FDR < 0.01. WBPaper00062354:H.zoospora_6h_regulated
  Transcripts that showed significantly increased expression in nas-38(ok3407) comparing to in N2. A feature was classified upregulated if its FDR-corrected p-value was <= 0.05 and fold change was >= 2. Analogously, a gene was classified downregulated if its FDR-corrected p-value was <= 0.05 and fold change was <= -2. WBPaper00060703:nas-38(ok3407)_upregulated
  Transcripts that showed significantly decreased expression in daf-16(RNAi) comparing to in N2. DESeq2 1.30.1, fold change > 2, FDR < 0.05. WBPaper00066890:daf-16(RNAi)_downregulated
  Transcripts that showed significantly decreased expression in pha-4(RNAi) comparing to in N2. DESeq2 1.30.1, fold change > 2, FDR < 0.05. WBPaper00066890:pha-4(RNAi)_downregulated
  Genes significantely Up-regulated by GRO-seq in csr-1 hypomorph vs. N2 using DESeq p < 0.05. DESeq package with an FDR of < 0.05. WBPaper00045050:csr-1(hypomorph)_upregulated
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts down regulated in hpl-2(tm1489) embryo comparing to N2 in tiling array analysis. Oligos from the tiling array were mapped to chromosome coordinates of the exons from Wormbase WS180. Any oligo that mapped to a gene on both the Watson and Crick strands was excluded. The remaining oligos were then grouped together (perfect match and mismatch) into probe sets and written out into an Affymetrix CDF file. The CDF file was converted into an R-package and loaded into R. The expression values were calculated using the justRMA function from Bioconductor. This used a Benjamini and Hochberg false discovery rate correction. WBPaper00040560:hpl-2_embryo_downregulated
  Germline-intrinsic transcripts. Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization. [cgc6390]:intrinsic
  Transcripts that showed significantly increased expression in lin-29(n333) comparing to in N2 at day 1 adult stage. DESeq2, FDR < 0.01, fold change > 2. WBPaper00066970:lin-29(n333)_upregulated
  Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
  Transcripts that showed significantly increased exression in animals exposed to 100uM cadmium for 24 hours. DESeq2 v1.20.0, fold change > 2, FDR < 0.05. WBPaper00065029:cadmium_upregulated
  Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2. DESeq2 Benjamini-Hochberg adjusted p-value < 0.05. WBPaper00049545:jmjd-3.1(+)_upregulated
  Transcripts that showed significantly increased expression in dpy-7(e88) animals comparing to N2 animals. Authors considered genes differentially expressed if they had a q-value <= 0.05 and a b-value >= 1 or <= -1. WBPaper00053771:up_at_dpy-7(e88)
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
Acidic Environment: PH 4.33 vs. PH 6.33. Transcripts that showed significantly increased expression after 3 hours of exposure to acidic environment (PH 4.33), comparing to control animals exposed to PH 6.33 environment. DESeq2 (1.16.1). The Benjamini and Hochberg's approach was used to adjust the resulting P-values to control the false discovery rate. Corrected value of P < 0.05 and fold change > 2 were set as the threshold for significantly differential expression. WBPaper00060434:pH4.33_vs_pH6.33_uprgulated
feeding/starvation A large cluster of genes up-regulated during early larval development.. For each average expression value, the larger of the model-based error and empirical error was reported. ANOVA and T-tests were also computed in Rosetta Resolver using the reported errors. Expression values, errors, and P-values corresponding to transcript detection, ANOVAs, and T-tests were exported from Rosetta Resolver and analyzed elsewhere. WBPaper00032948:FedUp
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the second UVC dose (24h). Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the -25h timepoint. Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_EtBr-exposed_24h
  Genes with expression 1.5X depleted in PVD and OLL neurons. Data sets were normalized by RMA and transcripts showing relative PVD enrichment (>=1.5X) vs. the reference sample were identified by SAM analysis (False Discovery Rate, FDR < 1%) WBPaper00036375:depleted_in_PVD_OLL
  Transcripts that showed significantly increased expression in eat-2(ad465); acs-20(tm3232) comparing to in eat-2(ad465) animals at L4 larva stage. DESeq2 WBPaper00066265:eat-2(ad465);acs-20(tm3232)_vs_eat-2(ad465)_upregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin_downregulated

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : No expression after L1. Strain: BC11946 [F30H5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGGGAGTACGGTGGGTTAC] 3' and primer B 5' [TGAATTGTCTGATGGTTGATTTG] 3'. Expr5920 Larval Expression: intestine; unidentified cells in head;  
Original chronogram file: chronogram.1613.xml [F30H5.2:gfp] transcriptional fusion. Chronogram584    
    Expr1023252 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1149873 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
Transgenic lines were generated by coinjection of the nlp::gfp construct (5070 ng/ul) and lin-15 rescue construct (pJM24,100 ng/ul) into lin-15(n765ts) animals. At least two independent transgenic lines were analyzed for each nlp gene; 510 animals were scored per line. 1,1'-Dioctadecyl-3,3,3',3 -tetramethylindodicarbocyanine perchlorate (Molecular Probes) was used to stain amphid and phasmid neurons to facilitate identification.   Expr1697 No expression observed.  
    Expr2014297 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2032538 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

3 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  involved_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00003770 486114 486547 -1

3 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
434

1 Sequence Ontology Term

Identifier Name Description
gene  

3 Strains

WormBase ID
WBStrain00050939
WBStrain00050879
WBStrain00001959

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_486548..488763   2216 III: 486548-488763 Caenorhabditis elegans