WormMine: Gene WBGene00003996

• WormBase Gene ID: WBGene00003996
• Gene Name: pgp-2
• Sequence Name: C34G6.4
• Brief Description: pgp-2 encodes a member of the ABC transporter family with highest similarity to the vertebrate MDR (multidrug resistance) family and that is orthologous to human MDR1 (ABCB1; OMIM:171050, mutated in Crohn disease); during development, pgp-2 activity is required, in parallel with that of the AP-3 adaptor complex, for the proper formation of gut granules, lysosome-related organelles found in the C. elegans intestine; pgp-2 is expressed in the intestine, from the E2 stage of embryonic development through adulthood; PGP-2 localizes to the gut granule membrane.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATPase-coupled transmembrane transporter activity. Involved in gut granule assembly and lipid storage. Located in gut granule membrane. Expressed in AWAL and AWAR. Human ortholog(s) of this gene implicated in several diseases, including carcinoma (multiple); inflammatory bowel disease (multiple); and intrahepatic cholestasis (multiple). Is an ortholog of human ABCB1 (ATP binding cassette subfamily B member 1); ABCB11 (ATP binding cassette subfamily B member 11); and ABCB4 (ATP binding cassette subfamily B member 4).
• Biotype: SO:0001217
• Genetic Position: I :0.472587 ±0.000649
• Length (nt): 9361

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003996

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C34G6.4a.1	C34G6.4a.1	4164	I: 5886613-5895969
Transcript:C34G6.4b.1	C34G6.4b.1	3891	I: 5886625-5895636
Transcript:C34G6.4d.1	C34G6.4d.1	4331	I: 5888668-5895973
Transcript:C34G6.4c.1	C34G6.4c.1	4323	I: 5888744-5895969

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C34G6.4c	C34G6.4c	3870	I: 5888864-5888916
CDS:C34G6.4d	C34G6.4d	3798	I: 5888864-5888916
CDS:C34G6.4a	C34G6.4a	3819	I: 5886625-5886698
CDS:C34G6.4b	C34G6.4b	3891	I: 5886625-5886698

14 RNAi Result

• WBRNAi00007426
• WBRNAi00041930
• WBRNAi00102049
• WBRNAi00090545
• WBRNAi00003083
• WBRNAi00023077
• WBRNAi00114318
• WBRNAi00091097
• WBRNAi00077357
• WBRNAi00111093
• WBRNAi00116857
• WBRNAi00023158
• WBRNAi00023670
• WBRNAi00023958

94 Allele

• gk962858
• gk962706
• gk963902
• gk964505
• WBVar00240861
• WBVar01431751
• tm10946
• WBVar01327472
• gk685018
• gk596363
• gk602593
• ttTi20138
• WBVar00153855
• gk365563
• WBVar00153856
• WBVar01283032
• gk312761
• WBVar01283031
• gk312306
• WBVar01283030
• WBVar01399004
• gk888852
• gk401530
• gk397161
• WBVar01283035
• gk586319
• WBVar01283034
• gk428088
• gk833752
• WBVar01909611

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003996
• Start: 5886613
• End: 5895973
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_5895974..5896617
• Length (nt): 644
• Chromosome Location: I: 5895974-5896617
• Organism: Caenorhabditis elegans

190 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in vit-2(ac3); zcIs4, comparing to parenting strain SJ4005 [zcIs4].	Differential gene expression analysis was then performed on normalized samples. Genes exhibiting at least twofold change and a false-discovery rate (FDR) of 1% or less were considered differentially expressed.	WBPaper00051305:vit-2(ac3)_downregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
	Transcripts that showed significantly decreased expression in N2 day 4 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day4_vs_Day1_downregulated_Nanopore
	Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day7_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Nanopore

14 Expression Patterns

• Primary Identifier: Expr4687
• Pattern: Embryonic expression of pgp-2::gfp was first seen in the daughters of the E blastomere (E2 stage), which generate the intestine. Intestinal expression persisted through embryogenesis and into adulthood. Rarely, weak expression of pgp-2::gfp was detected in embryonic and adult hypodermal cells. Pharyngeal or AWA expression of the pgp-2::gfp reporter were never detected.

• Primary Identifier: Expr4688
• Subcellular Localization: Intestinally expressed PGP-2::GFP was localized to prominent vesicular structures and the plasma membrane in embryos and adults. Similar organelles were stained by anti-PGP-2 antibodies. Anti-PGP-2 antibodies only stained intracellular compartments in embryos and adults, suggesting that the PGP-2::GFP might be partially mislocalized to the plasma membrane. PGP-2::GFP colocalized with birefringent material and the V-ATPase subunit FUS-1 in embryos, and in adults PGP-2::GFP colocalized with autofluorescent compartments. PGP-2 antibodies stained compartments containing GLO-1::GFP. These results indicate that PGP-2 and PGP-2::GFP are associated with the gut granule membrane.

• Primary Identifier: Expr4575
• Remark: Reporter gene fusion type not specified.
• Pattern: To identify the expression sites of the ABC transporter PGP-2, five independent reporter gene expressing strains carrying a pgp-2::GFP fusion construct were generated and analysed. In all cases, PGP-2-GFP was found in the AWA sensory neuron pair. This conclusion was validated by analysing the morphology of the cilia. The PGP-2 expressing neurons showed the characteristic branched cilium morphology typical of the AWA neurons.

• Primary Identifier: Expr5427
• Remark: Strain: BC10011
• Reporter Gene: [pgp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATGAGGAGGCGAATGAAG] 3' and primer B 5' [ggggaaagcggagagaaa] 3'.
• Pattern: Adult Expression: pharynx; intestine; Larval Expression: pharynx; intestine

• Primary Identifier: Expr5428
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14931
• Reporter Gene: [pgp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTTTCGTTTTAAGGACTTGCTG] 3' and primer B 5' [TTTTTCGGCTTTTGATCAGTTAG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr1031912
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr3341
• Pattern: Expressed in pharynx 1st and 2ed bulb.

• Primary Identifier: Expr15843
• Pattern: We generated reporters for two predicted ODR-7 target genes, ins-1 and pgp-2, and found that both express in AWA.

• Primary Identifier: Chronogram121
• Remark: Original chronogram file: chronogram.1128.xml
• Reporter Gene: [C34G6.4:gfp] transcriptional fusion.

• Primary Identifier: Expr10410
• Pattern: Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/

• Primary Identifier: Expr1145937
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2033104
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2014869
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1013723
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

15 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003996
• Start: 5886613
• End: 5895973
• Strand: 1

15 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 9361

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00035530
• WBStrain00001117
• WBStrain00003300
• WBStrain00007854

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_5883990..5886612
• Length (nt): 2623
• Chromosome Location: I: 5883990-5886612
• Organism: Caenorhabditis elegans