WormMine: Gene WBGene00004729

• WormBase Gene ID: WBGene00004729
• Gene Name: sax-3
• Sequence Name: ZK377.2
• Brief Description: sax-3 encodes, by alternative splicing, two isoforms of an ortholog of Drosophila ROUNDABOUT, ROBO3, and LEAK, and of human ROBO1, ROBO2 (OMIM:602431, mutated in vesicoureteral reflux), and ROBO3 (OMIM:608630, mutated in horizontal gaze palsy with progressive scoliosis); in larval hermaphrodites, SAX-3 is required to confine migrating sex myoblasts to the ventral muscle quadrants during their migration through the body and for multiple aspects of sensory, motor, and interneuron axon guidance.
• Organism: Caenorhabditis elegans
• Automated Description: Enables axon guidance receptor activity. Involved in generation of neurons and regulation of sensory neuron axon guidance. Located in plasma membrane. Expressed in several structures, including QR.a; QR.p; body wall musculature; neuroblasts; and neurons. Human ortholog(s) of this gene implicated in several diseases, including autosomal recessive congenital nystagmus; hematologic cancer (multiple); and myositis (multiple). Is an ortholog of human ROBO1 (roundabout guidance receptor 1); ROBO2 (roundabout guidance receptor 2); and ROBO3 (roundabout guidance receptor 3).
• Biotype: SO:0001217
• Genetic Position: X :-10.3398 ±0.007528
• Length (nt): 14020

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004729

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK377.2b.1	ZK377.2b.1	4495	X: 3451908-3465927
Transcript:ZK377.2a.1	ZK377.2a.1	4452	X: 3451937-3465925

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK377.2b	ZK377.2b	3822	X: 3452496-3452572
CDS:ZK377.2a	ZK377.2a	3810	X: 3452496-3452572

6 RNAi Result

• WBRNAi00009467
• WBRNAi00009468
• WBRNAi00067130
• WBRNAi00059385
• WBRNAi00086088
• WBRNAi00086133

171 Allele

• gk963725
• gk964260
• WBVar01601371
• WBVar01601370
• WBVar01601369
• gk5367
• gk275892
• gk275885
• gk275878
• gk721788
• gk774215
• WBVar00077122
• WBVar00077123
• WBVar00077121
• WBVar02026922
• WBVar02026923
• WBVar01825047
• gk950956
• gk598866
• gk333433
• gk869316
• gk614644
• WBVar01998626
• gk921907
• gk375245
• gk444287
• gk560247
• gk748456
• gk873264
• gk677092

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004729
• Start: 3451908
• End: 3465927
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_3451223..3451907
• Length (nt): 685
• Chromosome Location: X: 3451223-3451907
• Organism: Caenorhabditis elegans

135 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Genes upregulated in dcr-1(-/-) adult animals by at least 1.5 fold and P < 0.01, as determined by a multisample t-test and the Benjamini and Hochberg false discovery rate correction.	Statistical t-test: P < 0.05 for rde-4(-/-) and rde-1(-/-) analyses; P < 0.01 for dcr-1(-/-) analysis with a threshold of 1.5-fold misregulation.	WBPaper00029437:dcr-1_upregulated
	Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(ot269)_upregulated
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated

17 Expression Patterns

• Primary Identifier: Expr1162812
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr14627
• Pattern: sax-3 was expressed in the muscles and many neurons, including ALA and PVD.

• Primary Identifier: Expr716
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Expression observed in most or all neurons at high levels as well as in some hypodermal and muscle cells. In most neurons, sax-3::GFP expression is transient, peaking during the period of axon outgrowth. Highest level of expression is observed in the embryo, particularly during the initial period of axon outgrowth at 350-400 min (comma-stage). At comma-stage high level of expression is observed in anterior embryo, including most developing neurons of the nerve ring and a swath of ventral cells that includes the developing motor neurons of the ventral nerve cord and posterior neurons such as PVQ. Lower level of expression is observed in the epidermal cells. 200-400 - cell stage; 200-300 min of development: Expression seen in all epidermal cells at low level. 3-fold stage; >500 min of development: Expression seen in muscles that extend from nerve ring to the anterior tip of the head. L1: Expression in motor neurons in the head including RMD, RMG, SMD, SIA and SIB neurons; projection interneurons in the head and tail, including AVA, AVB, PVC, AVD, PVQ and ALA neurons; and the sensory OLQ neuron. This neuronal expression diminishes throughout postembryonic development. During L1, expression persists in the head muscles and appears in muscles along the body wall, with ventral muscles expressing more strongly than posterior muscles. This expression continues until the adult stage. Epidermal expression was rarely seen in larval stages. L2: Expression observed in HSN motor neurons. HSN motor neurons extends a growth cone (axon from their lateral cell bodies) towards the ventral midline and expression is at its highest at this point. L3: Expression observed in the axon reaching the ventral nerve cord. L4: Expression continues in HSN, when HSN axon grows anteriorly to the head. Adult: Expression decreases in HSN at this stage after the completion of HSN axon outgrowth. In addition expression observed in motor neurons, interneurons and sensory neurons listed above also postembryonic ventral cord motorneurons, some interneurons from the tail and head, body wall and vulval muscles.

• Primary Identifier: Expr15406

• Primary Identifier: Expr3685
• Pattern: SAX-3::GFP is expressed in early neuroblasts during gastrulation cleft closure and in the underlying neurons during ventral enclosure, similar to VAB-1 and EFN-1. However, unlike VAB-1 or EFN-1, SAX-3::GFP was also observed in epidermal cells . To examine SAX-3 and VAB-1 co-localization, anti-VAB-1 antibodies and anti-GFP antibodies were used on transgenic embryos expressing VAB-1 (pCZ47) and the SAX-3::GFP construct. VAB-1 and SAX-3 co-localized on neuroblasts. However, the co-localization is not exact and VAB-1 and SAX-3 were also expressed in separate cells.

• Primary Identifier: Expr7210
• Remark: Strain: BC13549
• Reporter Gene: [sax-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGATTTGAAAACGCGACAGT] 3' and primer B 5' [TTGTTTTATTCAATCTGTGTCCAA] 3'.
• Pattern: Adult Expression: anal depressor muscle; body wall muscle; unidentified cells in head; Larval Expression: anal depressor muscle; body wall muscle; unidentified cells in head

• Primary Identifier: Expr1032333
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr13760
• Pattern: A GFP construct driven by a 4-kb sax-3 promoter revealed a wide sax-3 expression pattern in the nervous system. Psax-3::GFP is present in both RMED and RMEV neurons. sax-3 expression begins around the midembryonic stage (350 min) and is restricted to the anterior region of an embryo, where the neurons or neuroblast cells are clustered. SAX-3::GFP is distributed on the membrane surfaces of those cells. When embryos progressed to the late-embryonic stage (500 min), SAX-3::GFP is detected on RME cells.
• Subcellular Localization: SAX-3::GFP is distributed on the membrane surfaces of neuroblasts.

• Primary Identifier: Expr13762
• Subcellular Localization: SAX-3::GFP is distributed on the elongating neurites. Intriguingly, SAX-3::GFP is asymmetrically distributed on the posterior sides of RMED and RMEV cell bodies, from which the neurites are elongating.

• Primary Identifier: Expr13763
• Subcellular Localization: SAX-3::GFP is distributed on the elongating neurites. Intriguingly, SAX-3::GFP is asymmetrically distributed on the posterior sides of RMED and RMEV cell bodies, from which the neurites are elongating.

• Primary Identifier: Expr13291
• Pattern: sax-3 is expressed in VNC neurons. A SAX-3::GFP transgene showed low levels of expression and GFP signal, making it difficult to quantify. However, in a small fraction of embryos with relatively high signal (n = 2), the localization patterns resemble that of VANG-1 qualitatively (See Expr13290).

• Primary Identifier: Expr11154
• Subcellular Localization: The localization of SAX-3::GFP was investigated in the PDE neurons. In L4 stage wild-type worms, SAX-3::GFP was predominantly localized on the cell membrane and axons, and was also associated with small vesicles that were uniformly distributed in the cytoplasm.

• Primary Identifier: Chronogram406
• Remark: Original chronogram file: chronogram.1418.xml
• Reporter Gene: [ZK377.2:gfp] transcriptional fusion.

• Primary Identifier: Expr15970
• Pattern: We found that sax-3 is expressed in the QR descendants.

• Primary Identifier: Expr2015608
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1011333
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2033843
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

15 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004729
• Start: 3451908
• End: 3465927
• Strand: -1

15 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 14020

1 Sequence Ontology Term

• Name: gene

11 Strains

• WBStrain00047620
• WBStrain00054911
• WBStrain00008611
• WBStrain00002638
• WBStrain00005236
• WBStrain00008615
• WBStrain00008616
• WBStrain00005237
• WBStrain00008614
• WBStrain00008620
• WBStrain00008613

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_3465928..3467489
• Length (nt): 1562
• Chromosome Location: X: 3465928-3467489
• Organism: Caenorhabditis elegans