WormMine: Gene WBGene00004949

• WormBase Gene ID: WBGene00004949
• Gene Name: sox-2
• Sequence Name: K08A8.2
• Brief Description: sox-2 encodes, by alternative splicing, three isoforms of a putative HMG-box transcription factor orthologous to human SOX1 (OMIM:602148), SOX2 (OMIM:184429, mutated in syndromic anophthalmia), and SOX3 (OMIM:313430, mutated in hypopituitarism), and paralogous to SOX-3; SOX-2 is required for normal embryonic and larval viability, fertility, egg-laying, locomotion, and normally rapid growth; SOX-2 is expressed in larval and adult hypodermis and neurons; the sox-2 gene contains a predicted pan-neuronal regulatory motif.
• Organism: Caenorhabditis elegans
• Automated Description: Enables RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Involved in neuron fate specification. Predicted to be located in nucleus. Expressed in several structures, including AWC-ON; head neurons; hypodermis; neuroblasts; and rectal epithelial cell. Human ortholog(s) of this gene implicated in several diseases, including X-linked panhypopituitarism; carcinoma (multiple); and syndromic microphthalmia 3. Is an ortholog of human SOX2 (SRY-box transcription factor 2).
• Biotype: SO:0001217
• Genetic Position: X :-1.69696 ±0.006444
• Length (nt): 5457

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004949

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K08A8.2a.2	K08A8.2a.2	1881	X: 7458280-7463736
Transcript:K08A8.2b.2	K08A8.2b.2	1466	X: 7458282-7460311
Transcript:K08A8.2a.1	K08A8.2a.1	1625	X: 7458282-7460548
Transcript:K08A8.2b.3	K08A8.2b.3	1344	X: 7458286-7459752
Transcript:K08A8.2b.1	K08A8.2b.1	866	X: 7459017-7463736

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K08A8.2a	K08A8.2a	852	X: 7459017-7459397
CDS:K08A8.2b	K08A8.2b	600	X: 7459017-7459397

25 RNAi Result

• WBRNAi00064489
• WBRNAi00064732
• WBRNAi00050218
• WBRNAi00008969
• WBRNAi00025911
• WBRNAi00073201
• WBRNAi00073202
• WBRNAi00099857
• WBRNAi00100444
• WBRNAi00068539
• WBRNAi00068538
• WBRNAi00068541
• WBRNAi00068540
• WBRNAi00068542
• WBRNAi00068982
• WBRNAi00100818
• WBRNAi00099251
• WBRNAi00099655
• WBRNAi00099453
• WBRNAi00100070
• WBRNAi00034101
• WBRNAi00064172
• WBRNAi00101005
• WBRNAi00100631
• WBRNAi00100257

100 Allele

• gk964260
• WBVar01927295
• WBVar01927296
• WBVar01927297
• gk963873
• gk963874
• gk964088
• gk964087
• gk964005
• gk964003
• gk285249
• gk951476
• gk362520
• gk690600
• gk410119
• WBVar01815979
• WBVar01782281
• WBVar01601944
• gk465441
• tm5456
• WBVar01849142
• gk285251
• WBVar01883498
• WBVar01883499
• dev153
• WBVar02046547
• WBVar01815978
• WBVar00236390
• gk623139
• gk760894

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004949
• Start: 7458280
• End: 7463736
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_7458238..7458279
• Length (nt): 42
• Chromosome Location: X: 7458238-7458279
• Organism: Caenorhabditis elegans

209 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly decreased expression in 10-days post L4 adult hermaphrodite npr-8(ok1439) animals grown at 20C, comparing to in N2 animals.	CuffDiff, fold change > 2.	WBPaper00065096:npr-8(ok1439)_downregulated_Day10_20C
Growth temperature	Transcripts that are significantly downregulated at 15C compared to both 25C and 20C, with no statistical difference between 25C and 20C, in worms feeding B. subtilis PY79.	DESeq2 and EdgeR, adjusted p-value < 0.05.	WBPaper00053814:15C_downregulated_PY79
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:ubc-9(ne4833)_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
Starvation	Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl)	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:starvation_regulated_LowSalt
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult

14 Expression Patterns

• Primary Identifier: Expr2034248
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6357
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15438
• Reporter Gene: [K08A8.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGGGAAATATTGCTTACGTCG] 3' and primer B 5' [GTTAAACAACAATGATATGACACG] 3'.
• Pattern: Adult Expression: hypodermis; Nervous System; head neurons; amphids; Larval Expression: hypodermis; Nervous System; head neurons; amphids

• Primary Identifier: Expr9798
• Pattern: GFP was expressed in many neurons in the nerve ring and elsewhere in the head. GFP was also observed in the procorpus of the pharynx, in rectal cells and in hypodermal cells in larvae and adults. There was extensive GFP expression in the developing reproductive system from the L3 stage which was maintained into adulthood.

• Primary Identifier: Expr9801
• Pattern: GFP was expressed in many neurons in the nerve ring and elsewhere in the head. GFP was also observed in the procorpus of the pharynx, in rectal cells and in hypodermal cells in larvae and adults. There was extensive GFP expression in the developing reproductive system from the L3 stage which was maintained into adulthood.

• Primary Identifier: Expr9841
• Pattern: GFP was expressed in many neurons in the nerve ring and elsewhere in the head. GFP was also observed in the procorpus of the pharynx, in rectal cells and in hypodermal cells in larvae and adults. There was extensive GFP expression in the developing reproductive system from the L3 stage which was maintained into adulthood.

• Primary Identifier: Expr15717
• Pattern: sox-2ps::2xnlsGFP, was expressed in both AWC neurons at the L1 stage in the majority of wild-type animals.

• Primary Identifier: Expr12601
• Pattern: sox-2 expression is restricted to subsets of neuroblasts. sox-2 is expressed relatively late in nervous system development, in the progenitor of differentiated neurons, but not in earlier neuroectodermal cells. sox-2 is also expressed in some progenitors of non-neural tissue, in the head hypodermis and the arcade cells. sox-2 is expressed in several postembryonic blast cells that are generated in the embryo. These blast cells include the B, Y, F, U and K rectal epithelial cells and the seam cells along the body. Although expression of sox-2 is absent in the terminal neurons generated by these lineages, sox-2 expression extends beyond the blast cell stage [e.g. sox-2 expression is maintained in the V5 daughters (V5a and V5p) but is lost in the next division].sox-2 is expressed in the sensory neurons AWB, AWC, IL1, IL2, URA, URB, OLL, the interneurons AIM, AIN, AVK, RIH and the motor neuron class RME. The sox-2 fosmid reporter or sox-2 smFISH did not show any expression in the germ line or oocytes of young adult worms. Expression patterns obtained by smFISH were very similar to the ones observed with fosmid reporters.

• Primary Identifier: Expr12440
• Pattern: sox-2::gfp was expressed in the nucleus of both AWC and AWB neurons. The expression of sox-2 in AWC and AWB is maintained throughout life. sox-2 is also continuously expressed in other sensory neurons (IL1, IL2, URA, URB, OLL), interneurons (AIM, AIN, AVK, RIH), and motor neurons (RME), as well as in other tissues such as head hypodermis, arcade cells, and rectal epithelial cells.

• Primary Identifier: Expr1032463
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr15715
• Pattern: Like imb-2 and nsy-7, sox-2 was asymmetrically expressed at a higher level in AWCON neurons than in AWCOFF neurons in a stochastic manner.

• Primary Identifier: Expr1153914
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1024387
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram964
• Remark: Original chronogram file: chronogram.2016.xml
• Reporter Gene: [K08A8.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2016013
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

17 GO Annotation

63 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004949
• Start: 7458280
• End: 7463736
• Strand: -1

17 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5457

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00028920
• WBStrain00029588
• WBStrain00029587
• WBStrain00047519
• WBStrain00051988

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_7463737..7463756
• Length (nt): 20
• Chromosome Location: X: 7463737-7463756
• Organism: Caenorhabditis elegans