WormMine: Gene WBGene00005070

• WormBase Gene ID: WBGene00005070
• Gene Name: srb-5
• Sequence Name: C27D6.6
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway and sensory perception of chemical stimulus. Predicted to be located in dendrite; perikaryon; and plasma membrane. Expressed in ASKL and ASKR.
• Biotype: SO:0001217
• Genetic Position: II :-1.97153 ±0.00279
• Length (nt): 1389

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00005070

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C27D6.6.1	C27D6.6.1	1038	II: 5161995-5163383

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C27D6.6	C27D6.6	1038	II: 5161995-5162382

2 RNAi Result

• WBRNAi00041347
• WBRNAi00011258

18 Allele

• gk963801
• gk963053
• WBVar01437722
• WBVar00223585
• gk142343
• WBVar01989121
• WBVar01239890
• WBVar00171882
• gk579354
• gk822145
• gk590891
• gk823225
• WBVar02014319
• tm5831
• gk525083
• gk562234
• gk458891
• gk899815

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00005070
• Start: 5161995
• End: 5163383
• Strand: -1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_5161203..5161994
• Length (nt): 792
• Chromosome Location: II: 5161203-5161994
• Organism: Caenorhabditis elegans

31 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
20C vs 25C	Transcripts that showed differential expression in 20C vs 25C in mir-34(OverExpression) animals at adult stage.	N.A.	WBPaper00050488:20C_vs_25C_regulated_mir-34(OverExpression)_adult
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in sams-3(RNAi) comparing to N2 animals injected with empty vector.	Deseq FDR < 0.01, fold change > 2.	WBPaper00065005:sams-3(RNAi)_upregulated
	Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
	Significantly downregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:cyc-1(RNAi)_downregulated
	Genes that showed significant differential expressed between control and 150 mg\/L Atrazine treatment.	t-test, p < 0.05.	WBPaper00036123:Atrazine_regulated
	Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells).	Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations.	WBPaper00025141:unc-4::GFP_Expressed_Genes
Drug treatment: Rhine sediment	Genes with significantly changing transcripts in C. elegans exposed to the Rhine (R) sediment.	[ANOVA, p < 0.05 without multiple sample correction, fold-change to reference sediment Danube (D) > 1.4 (up-regulated) or < 0.7 (down-regulated)].	WBPaper00033070:Rhine_downregulated
	Transcripts that showed significantly decreased expression in drh-3(rrr2) comparing to in N2.	edgeR, log2 fold change > 2 or < -2.	WBPaper00053888:drh-3(rrr2)_downregulated
	Genes that showed significantly increased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control.	Fold change > 1.2 or < 0.8.	WBPaper00042477:rsr-2(RNAi)_upregulated_TilingArray
	Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:srj-42-srw-113
	Transcripts that showed significantly decreased expression in mrps-5(RNAi) animals comparing to animals injected with empty vector.	Differential expression was assessed using a Partial least-squares discriminant analysis (PLS-DA) using mixomics setting a variable of importance (VIP) score of greater than 1 as significant.	WBPaper00059328:mrps-5(RNAi)_downregulated_mRNA
	Genes that showed decreased expression in bar-1(ga80) animal comparing to in N2.	All statistical analyses were performed using the statistical programming language R (version 2.13.1 x 64). A linear model was used to determine the effect and significance of the genotype on the expression levels (probe intensity + genotype + error). Using permutations of the original data in the same linear model, authors determined thresholds adjusted for multiple testing (FDR 0.05: -log10(p) > 2; FDR 0.01: -log10(p) > 3). To correct for the developmental difference between bar-1(ga80) and N2 authors used the developmental gene expression data from Snoek et al. (2014) together with the gene expression data generated for this study (bar-1(ga80) vs. N2) in one linear model (probe intensity, sample age + genotype + error). The intensities were corrected for batch effect and for sample age authors used an age of 44 hours for the bar-1(ga80) samples (as estimated), and 48 hours for the N2 samples.	WBPaper00045257:bar-1(ga80)_downregulated
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_13
	Transcripts that showed significantly increased expression in FACS sorted neuron cells (labelled by pan-neuronal GFP) from edIs6[unc-119::GFP + rol-6(su1006)]; thoc-5(wy822) comparing to in edIs6.	DESeq2, log2 fold change > 2, adjusted p-value < 0.005.	WBPaper00055103:thoc-5(wy822)_upregulated
	Top 300 transcripts enriched in marginal cell according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Pharyngeal_marginal_cell
	Transcripts that showed differential expression in adult mir-34(gk437) vs adult mir-34(OverExpression) animals at 20C.	N.A.	WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_adult_20C
	Transcripts that showed differential expression in adult mir-34(OverExpression) vs adult N2 animals at 20C.	N.A.	WBPaper00050488:mir-34(OverExpression)_vs_N2_regulated_adult_20C
	Top 300 transcripts enriched in ALML, ALMR, PLML, PLMR according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:ALM_PLM
	Top 300 transcripts enriched in OLLL, OLLR according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:OLL
	Transcripts that showed significantly increased expression in spt-16(RNAi) comparing to in vector control worm at L4 larva stage.	DESeq 2, fold change > 4, adjusted p-value < 0.05.	WBPaper00055013:spt-16(RNAi)_downregulated
	Transcripts that showed significantly decreased expression in hmg-4(RNAi) comparing to in vector control worm at L4 larva stage.	DESeq 2, fold change > 4, adjusted p-value < 0.05.	WBPaper00055013:hmg-4(RNAi)_downregulated
	Genes altered by more than 2-Fold in late versus early generation prg-1 mutants and prg-1; daf-2 mutants. Samples include prg-1(pk2290), prg-1(n4357), prg-1(tm872), prg-1(pk2290); daf-2(e1368), prg-1(pk2290); daf-2(e1370), prg-1(tm872); daf-2(e1370), prg-1(tm872); daf-2(m41).	Genes with more than 2-fold change in expression level are considered differentially expressed.	WBPaper00045217:prg-1_progressively_regulated
	Single-cell RNA-Seq cell group 54_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:54_0
	Transcripts enriched in PVM according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:PVM_enriched
Bacteria infection: Burkholderia pseudomallei BpR15	Genes that showed decreased expression in adult animals after 8 hour exposure to B. pseudomallei R15 vs. exposure to OP50	After array normalization, significance analysis of microarray was performed on data from individual time points (two class unpaired response) to identify genes with small but consistent changes. A false-discovery rate (FDR) of ~1% was used as criteria to consider a gene differentially regulated.Authors chose this particular FDR because it was the lowest FDR that did not significantly reduce the number of estimated true positives.	WBPaper00044091:Bpseudomallei_repressed_8h
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at 3 h after the first UVC dose (3h).	Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the -45h timepoint.	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:control_vs_EtBr-exposed_3h

6 Expression Patterns

• Primary Identifier: Expr5357
• Remark: Also expressed in (comments from author) : ASK amphid neuron (Bargmann Lab 2005). Low intenstiy GFP. Strain: BC12285
• Reporter Gene: [srb-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCTTCAACTTCAGCTACTCAAT] 3' and primer B 5' [GATTAATCTCCGCGATTTTCTTT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; Larval Expression: Nervous System; head neurons; amphids

• Primary Identifier: Expr2034413
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr14020
• Pattern: ASK

• Primary Identifier: Expr2016185
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1026863
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1145387
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

10 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00005070
• Start: 5161995
• End: 5163383
• Strand: -1

10 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1389

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00002089

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_5163384..5163867
• Length (nt): 484
• Chromosome Location: II: 5163384-5163867
• Organism: Caenorhabditis elegans