WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005051 Gene Name  sra-25
Sequence Name  ? T26E3.9 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway and sensory perception of chemical stimulus. Predicted to be located in membrane. Expressed in head neurons and tail. Biotype  SO:0001217
Genetic Position  I :13.9235 ±0.003844 Length (nt)  ? 2091
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005051

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T26E3.9.1 T26E3.9.1 1008   I: 12686116-12688206
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T26E3.9 T26E3.9 1008   I: 12686116-12686358

2 RNAi Result

WormBase ID
WBRNAi00019257
WBRNAi00054204

49 Allele

Public Name
gk963849
gk964175
gk963095
WBVar01433955
WBVar01714435
WBVar01932787
gk963508
gk921229
gk511541
gk343945
WBVar00159487
gk442722
WBVar00159488
gk922899
gk642651
WBVar01993629
gk908414
gk625756
gk759875
gk667509
gk636680
gk674362
gk937175
WBVar02016786
WBVar01403837
cxTi7232
gk420448
gk774377
gk863164
gk653137

1 Chromosome

WormBase ID Organism Length (nt)
I Caenorhabditis elegans 15072434  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005051 12686116 12688206 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_12688207..12688726   520 I: 12688207-12688726 Caenorhabditis elegans

24 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:sre-33-ZK1025.1_8337
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(tm1630)_downregulated
  Genes with significantly increased expression in eat-2(ad465) treated with 2% DMSO for 72 hours, comparing to in N2 treated with 2% DMSO for 72 hours. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:eat-2(ad465)_upregulated_in-DMSO
  Transcripts down regulated in hpl-2(tm1489) embryo comparing to N2 in tiling array analysis. Oligos from the tiling array were mapped to chromosome coordinates of the exons from Wormbase WS180. Any oligo that mapped to a gene on both the Watson and Crick strands was excluded. The remaining oligos were then grouped together (perfect match and mismatch) into probe sets and written out into an Affymetrix CDF file. The CDF file was converted into an R-package and loaded into R. The expression values were calculated using the justRMA function from Bioconductor. This used a Benjamini and Hochberg false discovery rate correction. WBPaper00040560:hpl-2_embryo_downregulated
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h). Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-EtBr-exposed_48h
Temperature Shift: 25C vs 15C for 16 hours at L4 larva stage. Transcripts that showed significantly increased expression in AFD neurons comparing to in whole animals. DESeq2, fold change > 2, FDR < 0.05. WBPaper00065158:AFD_enriched
Temperature Shift: 25C vs 15C for 16 hours at L4 larva stage. Transcripts that showed significantly increased expression in AFD neurons at lin-15(n765ts); oyIs95 animals shifted from 20C to 25C for 16 hours at L4 larva stage, comparing to animals shifted from 20C to 15C for 16 hours at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00065158:25C_vs_15C_upregulated_AFD
  Transcripts that showed significantly decreased expression in drh-3(rrr2) comparing to in N2. edgeR, log2 fold change > 2 or < -2. WBPaper00053888:drh-3(rrr2)_downregulated
  Genes in the bottom 10% of expression level across the triplicate L3 samples. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. WBPaper00032528:L3_depleted
  Transcripts that showed significantly increased expression in sensory neuron (labeled by iaIs25[Pgcy-37::GFP + unc-119(+)]) comparing to in whole worm. Fold change > 2, p-value < 0.05. WBPaper00060661:sensory-neuron_enriched
Bacteria Diet: L. plantarum with pdxH mutant vs. L. plantarum Transcripts that showed significantly increased expression in N2 animals fed with L. plantarum with pdxH mutant, comparing to in N2 animals fed with L. plantarum. GFold3, logFC < -1 or > 1. WBPaper00066703:L.plantarum-pdxH_upregulated
  Transcripts that showed significantly increased expression in FACS sorted neuron cells (labelled by pan-neuronal GFP) from edIs6[unc-119::GFP + rol-6(su1006)]; thoc-5(wy822) comparing to in edIs6. DESeq2, log2 fold change > 2, adjusted p-value < 0.005. WBPaper00055103:thoc-5(wy822)_upregulated
  Transcripts that showed lower expression in neurons isolated from male day 2 vs day 8. DESeq2 analysis was then employed for read normalization and differential expression analysis of the counted reads. PCA analysiswas performed along with the DESeq2 package. Genes with a log2(fold-change) > 1 and p-adjusted < 0.05 were considered differentially expressed in subsequent analysis. WBPaper00066831:male-neuron_aging_upregulated
  Single-cell RNA-Seq cell group 77_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:77_0
  Top 300 transcripts enriched in AFDL, AFDR according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:AFD
  Top 300 transcripts enriched in AWAL, AWAR according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:AWA
  Top 300 transcripts enriched in ASIL, ASIR according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:ASI
  Single-cell RNA-Seq cell group 99_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:99_0
  Single-cell RNA-Seq cell group 35_3 expressed in neuron. scVI 0.6.0 WBPaper00065841:35_3

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034373 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Strain: BC12199 [sra-25::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCGGTTTCAGAGCGATTT] 3' and primer B 5' [CGATGAGCTCGTTGATAGCTT] 3'. Expr6780 Adult Expression: intestine; Nervous System; amphids; tail neurons; unidentified cells in tail ; Larval Expression: pharyngeal-intestinal valve; Nervous System; amphids; unidentified cells in tail ;  
Also expressed in (comments from author) : Mosaic population. Strain: BC13401 [sra-25::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCGGTTTCAGAGCGATTT] 3' and primer B 5' [CGATGAGCTCGTTGATAGCTT] 3'. Expr6781 Adult Expression: intestine; Nervous System; head neurons; amphids; Larval Expression: intestine; Nervous System; head neurons; amphids;  
    Expr14005 ASI, ASH, BAG (dim)  
    Expr2016138 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1157750 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1028201 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.226.xml [T26E3.9:gfp] transcriptional fusion. Chronogram1137    

6 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005051 12686116 12688206 1

6 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables

0 Regulates Expr Cluster

1 Sequence

Length
2091

1 Sequence Ontology Term

Identifier Name Description
gene  

4 Strains

WormBase ID
WBStrain00033352
WBStrain00062351
WBStrain00002576
WBStrain00002059

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_12685570..12686115   546 I: 12685570-12686115 Caenorhabditis elegans