WormMine: Gene WBGene00006525

• WormBase Gene ID: WBGene00006525
• Gene Name: tax-2
• Sequence Name: F36F2.5
• Brief Description: tax-2 encodes a cyclic nucleotide-gated channel beta subunit orthologous to the human gene ROD PHOTORECEPTOR CNG-CHANNEL BETA SUBUNIT (CNGB1; OMIM:600724), which when mutated leads to disease; TAX-2 activity is required for chemosensation, thermosensation, regulation of dauer larval development, normal axon guidance for some sensory neurons, and regulation of axonal outgrowth and morphology in late larval stages; a tax-2::GFP promoter fusion is expressed in nine pairs of amphid sensory neurons and a TAX-2::GFP fusion protein localizes to developing axons and sensory cilia.
• Organism: Caenorhabditis elegans
• Automated Description: Contributes to intracellularly cGMP-activated cation channel activity. Involved in several processes, including G protein-coupled receptor signaling pathway coupled to cGMP nucleotide second messenger; positive regulation of macromolecule biosynthetic process; and thermosensory behavior. Part of cation channel complex. Expressed in ciliated neurons. Human ortholog(s) of this gene implicated in achromatopsia 3 and retinitis pigmentosa 45. Is an ortholog of human CNGB1 (cyclic nucleotide gated channel subunit beta 1) and CNGB3 (cyclic nucleotide gated channel subunit beta 3).
• Biotype: SO:0001217
• Genetic Position: I :3.40539 ±0.013031
• Length (nt): 4664

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006525

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F36F2.5.1	F36F2.5.1	2458	I: 9020945-9025608

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F36F2.5	F36F2.5	2403	I: 9020945-9021025

3 RNAi Result

• WBRNAi00046497
• WBRNAi00003618
• WBRNAi00027700

73 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• gk964316
• gk964252
• sa1205
• WBVar01432417
• WBVar01432418
• WBVar01822912
• WBVar01910015
• p671
• tm3503
• p691
• p694
• WBVar02047940
• ok3356
• WBVar01391970
• tm8020
• oy17
• ot25
• ok3403
• gk745229
• ks10
• ky139
• ks15
• ks31
• gk920621
• WBVar00155489
• gk785107

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006525
• Start: 9020945
• End: 9025608
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_9025609..9025778
• Length (nt): 170
• Chromosome Location: I: 9025609-9025778
• Organism: Caenorhabditis elegans

91 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts enriched in ASG according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:ASG_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Single-cell RNA-Seq cell group 71_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:71_0
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
Bacteria infection: Serratia marcescens	Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray
	Genes that showed significantly decreased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_downregulated
	Transcripts that showed significantly increased expression in animals after 24 hours of exposure to 300mM NaCl comparing to control animals.	Authors considered genes differentially expressed if they had a q-value <= 0.05 and a b-value >= 1 or <= -1.	WBPaper00053771:up_at_24h-NaCl
	Transcripts that showed significantly increased expression in dpy-7(e88) animals comparing to N2 animals.	Authors considered genes differentially expressed if they had a q-value <= 0.05 and a b-value >= 1 or <= -1.	WBPaper00053771:up_at_dpy-7(e88)
	Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-2(e1370)_upregulated_neuron
	Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-16(mu86)_upregulated_neuron
20C vs 25C	Transcripts that showed differential expression in 20C vs 25C in mir-34(gk437) animals at adult stage.	N.A.	WBPaper00050488:20C_vs_25C_regulated_mir-34(gk437)_adult
	Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C.	N.A.	WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
	Transcripts that showed significantly increased expression in smn-1(ok355) heterozygots using balancer hT2 comparing to in N2.	DESeq v1.14.0, log2FC > 1, q <= 0.05.	WBPaper00056809:smn-1(ok355)_upregulated

14 Expression Patterns

• Primary Identifier: Expr2035441
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5971
• Remark: Strain: BC13780
• Reporter Gene: [tax-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCTGTCAAATACCGGGTT] 3' and primer B 5' [TGGAACTTGATAGATATCGGAAAA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; Larval Expression: intestine; hypodermis; Nervous System; head neurons; amphids

• Primary Identifier: Expr15431

• Primary Identifier: Expr1860
• Remark: Reference: Personal Communication from Cori Bargmann, June 19, 2002.
• Pattern: GFP is expressed in AWC, AFD, ASE, ASG, ASJ, AQR, PQR, BAG, ASK, ASI, and AWB neurons. All tax-2::gfp fusion genes were expressed continuously from about mid-embryogenesis until the adult stage.

• Primary Identifier: Expr1861
• Remark: Reference: Personal Communication from Cori Bargmann, June 19, 2002.
• Pattern: GFP expressed in the neurons AWC, AFD, ASE, ASI, AQR, PQR, BAG, and occasionally ASK. All tax-2::gfp fusion genes were expressed continuously from about mid-embryogenesis until the adult stage.

• Primary Identifier: Expr1862
• Remark: Reference: Personal Communication from Cori Bargmann, June 19, 2002.
• Pattern: GFP is expressed in the neurons AWB, AWC, ASG, ASI, ASK, and ASJ. All tax-2::gfp fusion genes were expressed continuously from about mid-embryogenesis until the adult stage.

• Primary Identifier: Expr1150375
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr8094
• Remark: Picture: Figure 3.
• Subcellular Localization: TAX-2 was localized in a discrete proximal domain of the AWB cilia.

• Primary Identifier: Expr1026462
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017306
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11197
• Reporter Gene: [srbc-66p::tax-2::gfp] translational fusion. srbc-66p::tax-2::gfp was generated by fusing tax-2 cDNA in frame to gfp in an expression vector containing 2.1 kb of srbc-66 upstream regulatory sequences (Kim et al., 2009).
• Subcellular Localization: TAX-2::GFP expressed under an AWB-specific promoter (str-1p::tax-2::gfp) was localized to a proximal region of each of the AWB neuron ciliary branches and excluded from the distal regions. The region of TAX-2 localization was distal to the basal body/transition fiber zone marked by CHE-13::TagRFP IFT protein accumulation, as well as the transition zone marked by localization of an MKSR-2::TagRFP fusion protein. The region of TAX-2::GFP localization was instead reminiscent of the Inversin compartment observed in several cilia types in vertebrates. As in mammalian cells, the Inversin homolog NPHP-2 is localized to the middle segment in C. elegans sensory cilia and shown to play a role in placement of the transition zone. The authors found that localization of TAX-2::GFP in AWB cilia overlapped almost fully with that of NPHP-2::mCherry. TAX-2::GFP expression was not observed in AWB axons. When expressed under an ASK-specific promoter (srbc-66), TAX-2 was localized to the middle segment, distal to the basal body/transition fiber region. Therefore TAX-2 is localized to the middle segments of both AWB and ASK cilia.

• Primary Identifier: Expr1863
• Remark: No detailed description on cellular expression patterns. Reference: Personal Communication from Cori Bargmann, June 19, 2002.
• Subcellular Localization: Strong tax-2::GFP expression was seen both in the sensory cilia and in the axons of the chemosensory neurons. Weaker fluorescence was visible in the dendrites and cell bodies. All tax-2::gfp fusion genes were expressed continuously from about mid-embryogenesis until the adult stage.

• Primary Identifier: Chronogram1342
• Remark: Original chronogram file: chronogram.2588.xml
• Reporter Gene: [F36F2.5:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1515
• Remark: Original chronogram file: chronogram.389.xml
• Reporter Gene: [F36F2.5:gfp] transcriptional fusion.

29 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006525
• Start: 9020945
• End: 9025608
• Strand: 1

29 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4664

1 Sequence Ontology Term

• Name: gene

18 Strains

• WBStrain00029323
• WBStrain00030780
• WBStrain00030788
• WBStrain00030790
• WBStrain00033139
• WBStrain00037482
• WBStrain00051527
• WBStrain00051715
• WBStrain00002732
• WBStrain00003905
• WBStrain00000314
• WBStrain00000315
• WBStrain00000313
• WBStrain00007496
• WBStrain00000316
• WBStrain00000317
• WBStrain00007497
• WBStrain00007499

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_9020305..9020944
• Length (nt): 640
• Chromosome Location: I: 9020305-9020944
• Organism: Caenorhabditis elegans