Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F19H8.1a.1 | F19H8.1a.1 |
3839
 |
II: 14600902-14610554 |
| Transcript:F19H8.1b.1 | F19H8.1b.1 |
744
|
II: 14609299-14610412 |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F19H8.1a | F19H8.1a |
3690
|
II: 14600909-14601249 |
| CDS:F19H8.1b | F19H8.1b |
744
|
II: 14609299-14609448 |
165 Allele
| Public Name |
|---|
| gk963801 |
| gk963053 |
| WBVar01320634 |
| WBVar01320638 |
| WBVar01320639 |
| gk962684 |
| WBVar01696535 |
| WBVar01696536 |
| WBVar01696537 |
| WBVar01696538 |
| WBVar01696534 |
| WBVar01606422 |
| tm622 |
| WBVar01267106 |
| WBVar01267117 |
| WBVar01540289 |
| WBVar01548079 |
| WBVar01548078 |
| WBVar01548075 |
| WBVar01548074 |
| WBVar01548077 |
| WBVar01548076 |
| WBVar01548080 |
| gk817996 |
| gk432047 |
| gk372973 |
| gk922239 |
| gk751935 |
| WBVar00232453 |
| gk885340 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00006603 | 14600902 | 14610554 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrII_14610555..14616034 | 5480 | II: 14610555-14616034 | Caenorhabditis elegans |
181 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. | SAM | WBPaper00031040:TGF-beta_adult_upregulated | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). | DESeq2, fold change >= 2, FDR <= 0.01. | WBPaper00056826:SGP_biased | |
| Genome-wide analysis of developmental and sex-regulated gene expression profile. | self-organizing map | cgc4489_group_18 | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day5_vs_Day1_downregulated | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day11_vs_Day1_downregulated | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_aging | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_regulated_aging | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141) | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. | DESeq2(v1.32.0), FDR < 0.05. | WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs | |
| Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. | Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:S.aureus-4h_upregulated_N2 |
| Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage. | DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05 | WBPaper00064632:daf-2(e1370)_upregulated_intestine | |
| Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. | DESeq2 version 1.22.2, p < 0.05 | WBPaper00064716:paraquat_downregulated | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals. | NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%. | WBPaper00064727:daf-2(e1370)_upregulated | |
| Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. | SAM algorithm with an FDR < 0.1. | WBPaper00033065:clk-1(qm30)_upregulated | |
| Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
| Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00065975:P-body_vs_oocyte_depleted |
12 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr2035610 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Strain: BC14876 | [tps-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCTGCGCGACAACCATT] 3' and primer B 5' [CTTGAGAAAACGCGATTATGG] 3'. | Expr5797 | Adult Expression: Reproductive System; vulval muscle; body wall muscle; Larval Expression: body wall muscle; | |
| Expr10725 | ||||
| Expr1032734 | Tiling arrays expression graphs | |||
| Expr15810 | tps-2p::gfp is strongly expressed in body wall muscles and likely the ciliated sensory neurons, but in contrast to the larval transcriptomics data, expression in the intestine and hypodermis is very weak. | |||
| Original chronogram file: chronogram.2020.xml | [F19H8.1:gfp] transcriptional fusion. | Chronogram969 | ||
| Expr10465 | Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| Expr10464 | Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| Expr10466 | Inferred Expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| Expr1010446 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2017471 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1149009 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 |
10 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables |
10 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrII_14597658..14600901 | 3244 | II: 14597658-14600901 | Caenorhabditis elegans |
