WormMine: Gene WBGene00006752

• WormBase Gene ID: WBGene00006752
• Gene Name: unc-13
• Sequence Name: ZK524.2
• Brief Description: unc-13 encodes at least five protein isoforms that regulate neurotransmitter release by altering the conformation of syntaxin; UNC-13 proteins are required for normal pharyngeal pumping and thrashing in liquid, normally short lifespan, normally large brood sizes, and full adult body sizes; UNC-13 proteins have orthologs in vertebrates and Drosophila; UNC-13 proteins are complex, with multiple C2, phorbol ester-binding, and DUF1041 domains; UNC-13 protein form is localized to most or all synapses; many of the unc-13 mutant alleles with viable phenotypes are transcript-specific, while homozygotes with an unc-13 null (deletion) allele die as paralyzed first-stage larvae.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable calmodulin binding activity and syntaxin-1 binding activity. Involved in regulation of multicellular organismal process; spermatogenesis; and synaptic vesicle exocytosis. Located in presynaptic active zone. Expressed in head neurons; neurons; tail neurons; and ventral nerve cord. Human ortholog(s) of this gene implicated in amyotrophic lateral sclerosis. Is an ortholog of human UNC13C (unc-13 homolog C).
• Biotype: SO:0001217
• Genetic Position: I :2.07486 ±0.004126
• Length (nt): 31332

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006752

Genomics

11 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK524.2d.1	ZK524.2d.1	6468	I: 7422785-7453729
Transcript:ZK524.2a.1	ZK524.2a.1	5829	I: 7422785-7454116
Transcript:ZK524.2f.1	ZK524.2f.1	5460	I: 7422785-7453729
Transcript:ZK524.2e.1	ZK524.2e.1	5451	I: 7422785-7453729
Transcript:ZK524.2i.1	ZK524.2i.1	5451	I: 7422785-7453729
Transcript:ZK524.2j.1	ZK524.2j.1	5406	I: 7422830-7453729
Transcript:ZK524.2k.1	ZK524.2k.1	5397	I: 7422830-7453729
Transcript:ZK524.2c.1	ZK524.2c.1	4428	I: 7433417-7453729
Transcript:ZK524.2h.1	ZK524.2h.1	4419	I: 7433417-7453729
Transcript:ZK524.2b.1	ZK524.2b.1	4540	I: 7443036-7453729
Transcript:ZK524.2g.1	ZK524.2g.1	4398	I: 7443169-7453729

Other

11 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK524.2a	ZK524.2a	5442	I: 7422785-7422857
CDS:ZK524.2f	ZK524.2f	5460	I: 7422785-7422857
CDS:ZK524.2e	ZK524.2e	5451	I: 7422785-7422857
CDS:ZK524.2c	ZK524.2c	4428	I: 7433417-7433628
CDS:ZK524.2h	ZK524.2h	4419	I: 7433417-7433628
CDS:ZK524.2b	ZK524.2b	4407	I: 7443169-7443945
CDS:ZK524.2g	ZK524.2g	4398	I: 7443169-7443945
CDS:ZK524.2d	ZK524.2d	6468	I: 7422785-7422857
CDS:ZK524.2i	ZK524.2i	5451	I: 7422785-7422857
CDS:ZK524.2j	ZK524.2j	5406	I: 7422830-7422857
CDS:ZK524.2k	ZK524.2k	5397	I: 7422830-7422857

24 RNAi Result

• WBRNAi00107783
• WBRNAi00113318
• WBRNAi00089793
• WBRNAi00066044
• WBRNAi00001144
• WBRNAi00059491
• WBRNAi00059492
• WBRNAi00004942
• WBRNAi00118012
• WBRNAi00113089
• WBRNAi00114353
• WBRNAi00060593
• WBRNAi00060595
• WBRNAi00060597
• WBRNAi00060598
• WBRNAi00060599
• WBRNAi00060592
• WBRNAi00060594
• WBRNAi00060596
• WBRNAi00060600
• WBRNAi00090018
• WBRNAi00090177
• WBRNAi00090336
• WBRNAi00114344

364 Allele

• gk962858
• gk962706
• gk963902
• otn10680
• s69
• s153
• s178
• WBVar00243630
• WBVar01432101
• WBVar01432103
• WBVar01432102
• WBVar00248558
• WBVar01712956
• WBVar01712957
• e51
• e1091
• e985
• e973
• e450
• e376
• e387
• e323
• e328
• e309
• e312
• e158
• e2312
• e2208
• e2274
• e1554

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006752
• Start: 7422785
• End: 7454116
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_7454117..7454659
• Length (nt): 543
• Chromosome Location: I: 7454117-7454659
• Organism: Caenorhabditis elegans

227 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_larva_enriched
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted

12 Expression Patterns

• Primary Identifier: Expr2035984
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr4522
• Subcellular Localization: Within the ventral nerve cord PDE-4 staining was observed in small, but variable, size spots that appeared to be distributed throughout the thickness of the cord. The size of these spots was close to the theoretical limit of resolution for light microscopy (~180 nm). Some of these spots appeared to lie within and/or just outside of the boundaries of cholinergic synaptic vesicle clusters, as visualized by costaining with an antibody to the synaptic vesicle ACh transporter UNC-17. A triple-staining experiment withanti-UNC-13L suggests that PDE-4 does not exclusively associate with cholinergic synapses, but is also found at or near noncholinergic synapses.

• Primary Identifier: Expr1162907
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1019688
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr7224
• Remark: Strain: BC13258
• Reporter Gene: [unc-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAACACCTTTCTTCAAATGTTCC] 3' and primer B 5' [TGATTGTTGAAACGTGGCATA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; mechanosensory neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; mechanosensory neurons; neurons along body; tail neurons

• Primary Identifier: Expr1073
• Remark: The staining in the nervous system appeared to be specific for UNC-13, because it was decreased in many unc-13 mutants. The nuclear staining in the gut and gonad was not altered in any of the unc-13 mutants and therefore is likely to be nonspecific. all neurons (author) = all stages (wjc)
• Pattern: Labeled most or all neurons as well as nuclei in the gut and gonad.
• Subcellular Localization: nuclei

• Primary Identifier: Expr1032826
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr11024
• Pattern: The expression of unc-13 was strictly restricted to most, if not all, neurons of the head and tail ganglia, and ventral nerve cord, and is consistent with previous results using specific antibodies.

• Primary Identifier: Chronogram517
• Remark: Original chronogram file: chronogram.1533.xml
• Reporter Gene: [ZK524.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2017848
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11231
• Subcellular Localization: UNC-13S had a diffuse distribution in axons and was less colocalized with UNC-10 RIM (presynaptic terminals localization).

• Primary Identifier: Expr11230
• Subcellular Localization: C. elegans UNC-13L (mCherry-tagged) and UNC-10 RIM (GFP-tagged) proteins were colocalized at presynaptic terminals, consistent with immuno-EM studies indicating that they are concentrated near dense projections (Weimer et al., 2006).

32 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006752
• Start: 7422785
• End: 7454116
• Strand: 1

32 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 31332

1 Sequence Ontology Term

• Name: gene

312 Strains

• WBStrain00022676
• WBStrain00022550
• WBStrain00022559
• WBStrain00022553
• WBStrain00022560
• WBStrain00022561
• WBStrain00022562
• WBStrain00022569
• WBStrain00022564
• WBStrain00022565
• WBStrain00022567
• WBStrain00022576
• WBStrain00023902
• WBStrain00023907
• WBStrain00023908
• WBStrain00023909
• WBStrain00023903
• WBStrain00023904
• WBStrain00023905
• WBStrain00023906
• WBStrain00023911
• WBStrain00023912
• WBStrain00023913
• WBStrain00023918
• WBStrain00023919
• WBStrain00023914
• WBStrain00023915
• WBStrain00023916
• WBStrain00023917
• WBStrain00023921

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_7408512..7422784
• Length (nt): 14273
• Chromosome Location: I: 7408512-7422784
• Organism: Caenorhabditis elegans