WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00006844 Gene Name  unc-120
Sequence Name  ? D1081.2 Brief Description  unc-120 encodes a member of the MADS-box family of transcription factors that is most closely related to Drosophila blistered and the vertebrate serum response factors (SRFs); UNC-120 is required for locomotion and muscle development and for formation of the normal number of muscle A and I bands; UNC-120 is also required for maintaining wild-type expression levels of the muscle components actin and myosin; UNC-120 is first expressed in the early embryo in body wall muscle precursors and later is expressed in both body wall and vulval muscles.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Acts upstream of or within positive regulation of muscle cell differentiation. Located in nucleus. Expressed in non-striated muscle and pharyngeal cell. Human ortholog(s) of this gene implicated in cardiomyopathy; congestive heart failure; and lymphangioleiomyomatosis. Is an ortholog of human SRF (serum response factor).
Biotype  SO:0001217 Genetic Position  I :2.83481 ±0.009013
Length (nt)  ? 2791
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00006844

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:D1081.2.1 D1081.2.1 1207   I: 8460225-8463015
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:D1081.2 D1081.2 984   I: 8460228-8460452

63 RNAi Result

WormBase ID
WBRNAi00089797
WBRNAi00043410
WBRNAi00072395
WBRNAi00077300
WBRNAi00077313
WBRNAi00003270
WBRNAi00074057
WBRNAi00074056
WBRNAi00074059
WBRNAi00074058
WBRNAi00024939
WBRNAi00024940
WBRNAi00068557
WBRNAi00068559
WBRNAi00068558
WBRNAi00068561
WBRNAi00068560
WBRNAi00064735
WBRNAi00064761
WBRNAi00064780
WBRNAi00064808
WBRNAi00064849
WBRNAi00074055
WBRNAi00068987
WBRNAi00030359
WBRNAi00074060
WBRNAi00072397
WBRNAi00072396
WBRNAi00074054
WBRNAi00086369

49 Allele

Public Name
gk962858
gk962706
gk963902
gk963849
gk964316
WBVar02122344
WBVar02121690
WBVar02123645
WBVar02124528
WBVar02124929
st364
WBVar02122418
WBVar02123646
WBVar02124751
WBVar02124451
gk434343
gk411961
gk863136
gk116945
gk116946
gk116951
gk808912
gk116952
gk704652
gk116953
gk473443
gk644651
gk116947
gk320647
gk116948

1 Chromosome

WormBase ID Organism Length (nt)
I Caenorhabditis elegans 15072434  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00006844 8460225 8463015 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_8463016..8463128   113 I: 8463016-8463128 Caenorhabditis elegans

169 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2. DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1. WBPaper00046012:tdp-1(ok803)_upregulated
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
  Transcripts expressed in vulva. FPKM >= 1. WBPaper00064122:vulva_transcriptome
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Transcripts that showed significantly decreased expression in N2 day 4 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day4_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly decreased expression in N2 day 5 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day5_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day7_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Expression Pattern Group C, enriched for genes involved in metabolic processes. The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05. WBPaper00036286:Pattern_C
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
Bacteria diet: Lb.rhamnosus Transcripts that showed significantly decreased expression in animals fed with heterofermentative LAB Lb. rhamnosus, comparing to animals fed with OP50 from day 1 to day 5 adult stage. fold change > 2 and p value < 0.05 by Students t- test. WBPaper00065392:Lb.rhamnosus_downregulated
  Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2. DESeq 2, fold change > 2, FDR < 0.05. WBPaper00065581:hpk-1(pk1393)_upregulated
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 4 hours at 25C. Transcripts that showed significantly decreased expression after N2 L4 animals were infected by P. aeruginosa (PA14) bacteria for 24 hours at 25C. DESeq R package (1.18.0), FDR < 0.05 and fold change > 2. WBPaper00062184:PA14_downregulated

11 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2035979 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12239 [unc-120::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGTAATAGAGCCCCGTGC] 3' and primer B 5' [TCGGTGATGTTCTGAAATTTTG] 3'. Expr5616 Adult Expression: stomato-intestinal muscle; anal depressor muscle; body wall muscle; Larval Expression: stomato-intestinal muscle; anal depressor muscle; body wall muscle;  
    Expr13700 GFP::UNC-120 expression was observed in the 95 BWM that run along the anterior-posterior axis, but also in the 20 gonadal sheath cells and in 55 cells in the head (37 pharyngeal muscle cells, nine marginal cells, and nine pharyngeal epithelial cells).  
    Expr7329 Click the movie links below for interactive 4D movies of a fluorescence reporter. http://glowormnotes.blogspot.com/2009/11/aff-1gfp-transcriptional-fusion_12.html  
    Expr1032901 Tiling arrays expression graphs  
    Expr1200163 Data from the TransgeneOme project  
    Expr12500 Strong unc-120 expression was limited to bodywall muscle cells and their precursors, beginning at 215 min of embryonic development, and in egg-laying muscles post-embryonically.  
Original chronogram file: chronogram.1352.xml [D1081.2:gfp] transcriptional fusion. Chronogram333    
    Expr1024213 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2017843 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1147398 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

15 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables
  enables
  enables
  located_in
  enables
  enables
  acts_upstream_of_or_within
  acts_upstream_of_or_within
  acts_upstream_of_or_within
  acts_upstream_of_or_within

5 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00006844 8460225 8463015 1

15 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables
  enables
  enables
  located_in
  enables
  enables
  acts_upstream_of_or_within
  acts_upstream_of_or_within
  acts_upstream_of_or_within
  acts_upstream_of_or_within

4 Regulates Expr Cluster

Regulated By Treatment Description Algorithm Primary Identifier
  Transcription factors down regulated by unc-120(st364). N.A. WBPaper00041222:unc-120(st364)_downregulated
  Transcripts that showed significantly increased expression in unc-120(st364) comparing to in N2 animals. Differentially expressed genes (defined by false discovery rate (FDR) step up <= 0.05, fold change >1.5) were identified by Gene-Specific Analysis. WBPaper00060634:unc-120(st364)_upregulated
  Transcripts that showed significantly decreased expression in unc-120(st364) comparing to in N2 animals. Differentially expressed genes (defined by false discovery rate (FDR) step up <= 0.05, fold change >1.5) were identified by Gene-Specific Analysis. WBPaper00060634:unc-120(st364)_downregulated
  Transcription factors up regulated by unc-120(st364). N.A. WBPaper00041222:unc-120(st364)_upregulated

1 Sequence

Length
2791

1 Sequence Ontology Term

Identifier Name Description
gene  

4 Strains

WormBase ID
WBStrain00029983
WBStrain00033502
WBStrain00033494
WBStrain00036753

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_8459332..8460224   893 I: 8459332-8460224 Caenorhabditis elegans