WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00006870 Gene Name  vab-3
Sequence Name  ? F14F3.1 Brief Description  vab-3 encodes a homeodomain protein that is the C. elegans Pax-6 orthologue; during development, vab-3 activity is required for proper patterning of anterior (head) hypodermal cells; vab-3 effects head development, in part, through positively regulating transcription of ceh-32, a Six/sine oculis class homeobox gene coexpressed with vab-3 in head hypodermis; vab-3 is also required for epidermal morphogenesis, epidermal cell fates, gonad cell migration and the development of sensory structures in the male tail; multiple genetic pathways including the Wnt signalling pathway and the homeobox gene, egl-5, regulate the expression of vab-3.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in several processes, including male anatomical structure morphogenesis; negative regulation of distal tip cell migration; and positive regulation of glial cell differentiation. Located in cytoplasm and nucleus. Expressed in several structures, including distal tip cell; head muscle; hypodermis; neurons; and somatic nervous system. Human ortholog(s) of this gene implicated in several diseases, including bilateral optic nerve hypoplasia; eye disease (multiple); and glucose intolerance. Is an ortholog of human PAX6 (paired box 6).
Biotype  SO:0001217 Genetic Position  X :2.22417 ±0.001647
Length (nt)  ? 19691
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00006870

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F14F3.1a.1 F14F3.1a.1 2598   X: 10499890-10519579
Transcript:F14F3.1a.2 F14F3.1a.2 2389   X: 10505896-10519580
Transcript:F14F3.1b.1 F14F3.1b.1 810   X: 10515424-10518651
Transcript:F14F3.1c.1 F14F3.1c.1 1824   X: 10516003-10519579
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F14F3.1a F14F3.1a 1368   X: 10505988-10505994
CDS:F14F3.1b F14F3.1b 810   X: 10515424-10515445
CDS:F14F3.1c F14F3.1c 891   X: 10516008-10516110

21 RNAi Result

WormBase ID
WBRNAi00044615
WBRNAi00114721
WBRNAi00013290
WBRNAi00027638
WBRNAi00101789
WBRNAi00063282
WBRNAi00063284
WBRNAi00075644
WBRNAi00115868
WBRNAi00107544
WBRNAi00065712
WBRNAi00075643
WBRNAi00063285
WBRNAi00063287
WBRNAi00085278
WBRNAi00075647
WBRNAi00107181
WBRNAi00107162
WBRNAi00107395
WBRNAi00117502
WBRNAi00117507

372 Allele

Public Name
gk964260
gk962707
WBVar01928162
WBVar01928163
WBVar01928164
WBVar01928165
WBVar01928166
gk357556
gk616360
ttTi17114
WBVar01759237
WBVar00063764
WBVar01759240
WBVar01759242
WBVar01759241
WBVar01759236
WBVar01759239
WBVar01759238
WBVar01551913
gk292035
gk292034
gk351344
WBVar01888788
gk703662
gk910972
gk312707
gk587153
WBVar01551910
WBVar01551929
gk644534

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00006870 10499890 10519580 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_10519581..10520816   1236 X: 10519581-10520816 Caenorhabditis elegans

189 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_upregulated
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_aging
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. WBPaper00040858:eQTL_regulated_reproductive
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
starvation 12 hours Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals. EdgeR, FDR < 0.05, fold change >= 2. WBPaper00067259:starvation_upregulated_intestine
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_upregulated
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background

22 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC10577 [vab-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTTTCGCGTGCACTTTTT] 3' and primer B 5' [TGAAACGTACCTGACATTTTGC] 3'. Expr5758 Adult Expression: Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons;  
    Expr9765 GFP expression was extremely weak. Although GFP was seen in embryos and L1 in all strains, in UL3504 there appeared to be expression in head hypodermis or muscle whereas in UL3501 expression was seen in the pharynx and some head neurons. UL3501 expresses slightly more strongly.  
    Expr9731 The image provided is for UL2932, but this strain was lost. However, GFP expression of UL3471 looked identical to that of UL2932. The GFP expression pattern in both strains looked like that for UL3244, for which gfp had been inserted directly upstream of the vab-3 stop codon, but weaker. It wasn't clear if GFP expression in the distal tip cell was also present. UL3469 had a more restricted expression than UL2932 or UL3471, with GFP in mostly only one neuron in the head but this could be due to greater mosaicism for the extrachromosomal transgenic array in this strain.  
Clone: pUL#JRH10B9   Expr7504 Expression from late embryo to adult. Complex expression in late embryo. Dorsal nerve cord, ventral nerve cord and two head nerves lateral to posterior pharyngeal bulb. Also gonad tip cells in L2/L3. Possibly artifactual expression in head muscles and intestine.  
    Expr14292 Short isoform. Both the pan-VAB-3 reporter transgene and the reporter for short homeodomain-only VAB-3 isoforms were expressed in BAG neurons. By contrast, the reporter for long VAB-3 isoforms that include the Paired homology domain was not expressed in BAG neurons.  
    Expr14293 All (VAB- 3A/B/C) isoforms. Both the pan-VAB-3 reporter transgene and the reporter for short homeodomain-only VAB-3 isoforms were expressed in BAG neurons. By contrast, the reporter for long VAB-3 isoforms that include the Paired homology domain was not expressed in BAG neurons.  
    Expr15646    
    Expr2036087 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1032912 Tiling arrays expression graphs  
Picture: Figure 1.   Expr8148 Both sexes bearing a vab-3::gfp transgene exhibit GFP expression in neuronal, and occasionally epidermal cell types in the head. Neuronal transcription begins after gastrulation and persists throughout the life of the animals. In addition, vab-3::gfp displays sex-specific expression patterns, such as in the distal tip cells (DTCs) of L4 hermaphrodites and the B.a and Y.p sensory organ precursors in males. vab-3::gfp transgene is not expressed in any ray lineages. vab-3::gfp expression is visible in the B.a and Y.p cells beginning in early L2. Expression levels among individual cell types derived from these precursors are not appreciably different through mid L3. In the B.a lineage, GFP persists through larval development. Expression diminishes during late L4 tail morphogenesis, and is absent in adults. Expression in the Y.p lineage shows a distinct temporal pattern. GFP in the Y.p lineage diminishes from mid L2 through mid L3, at which time only the eight B.a descendants exhibit expression.  
    Expr9742 GFP expression was seen from at least the bean stage of the embryo, through all stages to adulthood. GFP was present in anterior hypodermis, as well as in ventral nerve cord neurons and in the intestine and maybe head muscle. From the L3, GFP expression was also seen in the distal tip cell.  
    Expr16512 To investigate the expression pattern of vab-3, we used smFISH and found localization of vab-3 mRNAs in the anterior epidermis, as expected based on previous reports.  
Expression pattern at later stages were not described   Expr1552 Expression were first detected at around 150 cell stage, in the precursors of head hypodermis and neurons, and subsequently in the progeny of these cells. At the time when head neurons and hypodermal cells start to differentiate, vab-3 transcripts were expressed in a broad domain across the developing head.  
Expression pattern at later stages were not described Reporter gene fusion type not specified.   Expr1553 vab-3 was expressed strongly in almost all anterior hypodermal nuclei and weakly in many head neurons. nuclei
    Expr9757 This reporter gene fusion gave the strongest GFP expression out of the three different vab-3 promoters assayed by recombineering in this series. But this GFP expression pattern was also the most restricted of the three and was still very weak. GFP expression was only seen in head neurons, usually a pair, and possibly amphids. Occasionally a few (~5) other head nerve cells showed much weaker GFP expression. In the first few generations, as the transgenic strains were being established, nerve cell processes could be seen revealed with the GFP throughout the cells, but this subsided and the GFP became more restricted to the nuclei.  
    Expr11376 A fosmid-based vab-3 reporter is expressed in the OLL neurons, and this expression is maintained throughout the life of these neurons. Apart from OLL, expression of vab-3 is also observed in the glutamatergic ventral URY neuron class.  
    Expr1025077 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2017951 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1170036 Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191  
    Expr1148581 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr14294 Long Isoform. The reporter for long VAB-3 isoforms that include the Paired homology domain was not expressed in BAG neurons.  
Original chronogram file: chronogram.499.xml [F14F3.1:gfp] transcriptional fusion. Chronogram1616    

36 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  located_in
  located_in

11 Homologues

Type
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
orthologue
least diverged orthologue
orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00006870 10499890 10519580 1

36 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
19691

1 Sequence Ontology Term

Identifier Name Description
gene  

14 Strains

WormBase ID
WBStrain00029441
WBStrain00029447
WBStrain00029493
WBStrain00029665
WBStrain00030542
WBStrain00030543
WBStrain00031431
WBStrain00052005
WBStrain00007154
WBStrain00004234
WBStrain00005383
WBStrain00004190
WBStrain00004472
WBStrain00001415

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_10497140..10499889   2750 X: 10497140-10499889 Caenorhabditis elegans