WormMine: Gene WBGene00007443

• WormBase Gene ID: WBGene00007443
• Gene Name: pfd-1
• Sequence Name: C08F8.1
• Brief Description: pfd-1 encodes a putative prefoldin subunit 1, orthologous to human PFDN1 (OMIM:604897), that is required for normal microtubule nucleation and growth, embryonic viability, distal tip cell (DTC) migration, and locomotion; PFD-1 is expressed cytoplasmically in most, if not all, tissues; pfd-1(RNAi) animals have sterile progeny and are uncoordinated, and pfd-1(RNAi) embryos show a reduced microtubule growth rate; pfd-1(gk526) or escaper pfd-1(RNAi) hermaphrodites exhibit detective DTC migration.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable protein folding chaperone and unfolded protein binding activity. Involved in gonad development. Located in cytoplasm. Expressed in head muscle; pharyngeal muscle cell; and vulval muscle. Is an ortholog of human PFDN1 (prefoldin subunit 1).
• Biotype: SO:0001217
• Genetic Position: IV :4.91006 ±0.00115
• Length (nt): 818

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00007443

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C08F8.1a.1	C08F8.1a.1	464	IV: 11150113-11150930
Transcript:C08F8.1b.1	C08F8.1b.1	334	IV: 11150528-11150913

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C08F8.1a	C08F8.1a	354	IV: 11150115-11150222
CDS:C08F8.1b	C08F8.1b	243	IV: 11150528-11150670

34 RNAi Result

• WBRNAi00028689
• WBRNAi00040126
• WBRNAi00024507
• WBRNAi00040125
• WBRNAi00000775
• WBRNAi00008373
• WBRNAi00069156
• WBRNAi00105759
• WBRNAi00105754
• WBRNAi00105756
• WBRNAi00105755
• WBRNAi00105758
• WBRNAi00105757
• WBRNAi00105760
• WBRNAi00105762
• WBRNAi00105761
• WBRNAi00105764
• WBRNAi00105763
• WBRNAi00105766
• WBRNAi00105765
• WBRNAi00105768
• WBRNAi00105767
• WBRNAi00105770
• WBRNAi00105769
• WBRNAi00105772
• WBRNAi00105771
• WBRNAi00105774
• WBRNAi00105773
• WBRNAi00105776
• WBRNAi00105775

15 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• gk526
• gk832239
• gk857031
• gk739593
• gk490209
• gk611066
• gk212147
• gk212148
• WBVar01857823
• WBVar01857824
• WBVar01857825

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00007443
• Start: 11150113
• End: 11150930
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_11150931..11150996
• Length (nt): 66
• Chromosome Location: IV: 11150931-11150996
• Organism: Caenorhabditis elegans

85 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:oocyte_vs_mitosis_upregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
Bacteria infection: Streptococcus gordonii	Transcripts that showed significantly decreased expression after L4 larva animals were exposed to wild type S. gordonii for 2-3 hours, comparing to animals exposed to S. gordonii delta-spxB.	Fold change > 2, FDR corrected p-value < 0.05.	WBPaper00055049:S.gordonii_downregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector.	DESeq2. FDR < 0.05.	WBPaper00060459:bcat-1(RNAi)_downregulated
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Transcripts that showed significantly increased expression in set-2(zr2012) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(zr2012)_upregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_E
	Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
	Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C.	N.A.	WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched
Bacteria infection: Xenorhabdus nematophila	Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila.	Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets.	WBPaper00041606:CE_X.nematophila_regulated
feeding/starvation	A large cluster of genes up-regulated during early larval development..	For each average expression value, the larger of the model-based error and empirical error was reported. ANOVA and T-tests were also computed in Rosetta Resolver using the reported errors. Expression values, errors, and P-values corresponding to transcript detection, ANOVAs, and T-tests were exported from Rosetta Resolver and analyzed elsewhere.	WBPaper00032948:FedUp

9 Expression Patterns

• Primary Identifier: Expr5210
• Remark: Strain: BC13714
• Reporter Gene: [C08F8.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACAAACCGGACGAGAAGAAT] 3' and primer B 5' [CGGCGATTTCTGAAGTTGTAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; body wall muscle; excretory cell; Larval Expression: pharynx; intestine; body wall muscle

• Primary Identifier: Expr9564
• Remark: Operon: CEOP4420 Sub-cellular localization within the body wall muscle: Cytoplasm +/- Other
• Pattern: Adult Expression: pharynx; intestine; body wall muscle; excretory cell. Larval Expression: pharynx; intestine; body wall muscle
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Cytoplasm +/- Other

• Primary Identifier: Expr7844
• Remark: Picture: Supplementary Fig. 1A.
• Pattern: GFP expression was consistently observed in the muscles of the head, pharynx, body-wall and vulva of adult worms.
• Subcellular Localization: Expression present in the cytoplasm of many additional cells throughout the animal.

• Primary Identifier: Expr7839
• Remark: Picture: Supplementary Fig. 1A.
• Pattern: GFP expression was consistently observed in the muscles of the head, pharynx, body-wall and vulva of adult worms.

• Primary Identifier: Expr1033205
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1144198
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2014841
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1028881
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2033076
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

11 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00007443
• Start: 11150113
• End: 11150930
• Strand: 1

11 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 818

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00027644
• WBStrain00027643
• WBStrain00036248
• WBStrain00002703

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_11149771..11150112
• Length (nt): 342
• Chromosome Location: IV: 11149771-11150112
• Organism: Caenorhabditis elegans