WormMine: Gene WBGene00006999

• WormBase Gene ID: WBGene00006999
• Gene Name: zyx-1
• Sequence Name: F42G4.3
• Brief Description: zyx-1 encodes a LIM domain protein and is most similar to vertebrate Zyxin; the vertebrate zyxin sub-family also includes migfilin, TRIP6 and LPP; the ZYX-1 protein is expressed in striated body wall muscle and localizes at dense bodies/Z-discs and in the nucleus; ZYX-1 physically interacts with P granule components (GLH proteins) and several dense body and M-line proteins, including DEB-1 (Vinculin) and ATN-1 (alpha-actinin), indicating that zyx-1 may play a role in anchoring actin filaments to dense bodies via its interaction with these proteins.
• Organism: Caenorhabditis elegans
• Automated Description: Enables DEAD/H-box RNA helicase binding activity. Involved in maintenance of synapse structure. Acts upstream of or within with a positive effect on smooth muscle contraction. Located in M band; nucleus; and striated muscle dense body. Expressed in head; hypodermis; muscle cell; neurons; and tail neurons. Human ortholog(s) of this gene implicated in acute myeloid leukemia. Is an ortholog of human LPP (LIM domain containing preferred translocation partner in lipoma) and TRIP6 (thyroid hormone receptor interactor 6).
• Biotype: SO:0001217
• Genetic Position: II :13.979 ±0.069963
• Length (nt): 14362

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006999

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F42G4.3e.1	F42G4.3e.1	1944	II: 13057152-13071513
Transcript:F42G4.3a.1	F42G4.3a.1	2139	II: 13057152-13070976
Transcript:F42G4.3c.1	F42G4.3c.1	1014	II: 13060669-13070649
Transcript:F42G4.3d.1	F42G4.3d.1	738	II: 13064928-13070649
Transcript:F42G4.3b.1	F42G4.3b.1	1299	II: 13067009-13070975

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F42G4.3a	F42G4.3a	1812	II: 13057152-13057196
CDS:F42G4.3e	F42G4.3e	1944	II: 13057152-13057196
CDS:F42G4.3c	F42G4.3c	1014	II: 13060669-13060902
CDS:F42G4.3b	F42G4.3b	603	II: 13067379-13067394
CDS:F42G4.3d	F42G4.3d	738	II: 13064928-13065078

17 RNAi Result

• WBRNAi00047117
• WBRNAi00047118
• WBRNAi00109157
• WBRNAi00078451
• WBRNAi00014838
• WBRNAi00109546
• WBRNAi00032148
• WBRNAi00109255
• WBRNAi00091735
• WBRNAi00091705
• WBRNAi00091675
• WBRNAi00091771
• WBRNAi00091750
• WBRNAi00091720
• WBRNAi00091690
• WBRNAi00109352
• WBRNAi00109449

373 Allele

• gk963801
• gk963053
• gk962684
• gk962526
• gk962527
• WBVar01692099
• WBVar00244747
• WBVar00244746
• WBVar00244749
• WBVar00244748
• WBVar02067234
• WBVar01605895
• WBVar01261417
• WBVar01261428
• WBVar01261439
• WBVar01261450
• WBVar01261461
• WBVar01261473
• WBVar01821078
• h3572
• otn311
• gk964472
• gk942571
• WBVar01560990
• gk942572
• WBVar01560989
• WBVar02081314
• WBVar01560988
• WBVar02081313
• WBVar01560987

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006999
• Start: 13057152
• End: 13071513
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_13071514..13073479
• Length (nt): 1966
• Chromosome Location: II: 13071514-13073479
• Organism: Caenorhabditis elegans

246 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:Day1Adult_vs_Day8Adult_upregulated_neuron
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated

14 Expression Patterns

• Primary Identifier: Expr6050
• Remark: Strain: BC14247
• Reporter Gene: [zyx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGATTTCCTCAAAAGCTCATT] 3' and primer B 5' [GGGGTCCCATAGATCAGTAGC] 3'.
• Pattern: Adult Expression: anal sphincter; Reproductive System; vulval muscle; body wall muscle; Larval Expression: anal sphincter; Reproductive System; developing vulva; body wall muscle

• Primary Identifier: Expr6051
• Remark: Strain: BC14184
• Reporter Gene: [zyx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCTAAGAAACCTTTACGCAACTG] 3' and primer B 5' [TTGCATCCTGGCTGGTCT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; spermatheca; body wall muscle; Nervous System; head neurons; Larval Expression: pharynx; body wall muscle; Nervous System; head neurons

• Primary Identifier: Expr8311
• Remark: Picture: Figure 6.
• Pattern: The zyx-1 gene is expressed in muscles and neurons.
• Subcellular Localization: In muscle cells, the ZYX-1 protein is localized in the nucleus as well as at the dense bodies and M-lines. Staining zyx-1:gfp transgenic worms with MH24 and anti-DYC-1 antibodies showed an overlapping localization of ZYX-1-GFP and DEB-1, whereas DYC-1 was located at the margins of the ZYX-1-GFP dense body dots.

• Primary Identifier: Expr11983
• Pattern: GFP-ZYX-1B and ZYX-1-GFP were both expressed broadly in neurons and muscle throughout development, while mCherry-ZYX-1 was expressed at low levels throughout development.

• Primary Identifier: Expr10630
• Pattern: The expression of this ZYX-1-GFP protein was observed in spermatheca, body wall muscles as well as neurons. The expression was confirmed with anti ZYX antibodies but the signal was weaker.
• Subcellular Localization: The ZYX-1-GFP protein was detected at dense bodies and M-lines, as well as in the nucleus of body wall muscle cells, and in both cell bodies and axons of neurons. The ZYX- 1-GFP protein mainly localized in the middle region of dense bodies and partially overlaps with the ATN-1 and the DEB-1 containing regions.Immunoelectron microscopy experiments on transgenic zyx-1::gfp expressing worms showed a localization of the ZYX-1-GFP protein at dense bodies, over the whole length of M-lines, and in the nucleus. FRAP experiments indicate that ZYX-1 is a highly dynamic protein within the muscle cell and may shuttle between muscle adhesion complexes and the nucleus.

• Primary Identifier: Expr16514
• Pattern: Next, we looked for expression of zyx-1 isoforms as reported via extrachromosomal arrays by Luo and colleagues. In line with their report, we also observe the zyx-1 long isoform predominantly in tail neurons, and faintly in body wall muscle, and additionally also faintly in the pharynx, and more brightly in an unidentified structure in the head. Interestingly, the short zyx-1b isoform is also strongly expressed in body wall and vulval muscle (Luo and colleagues), where we observe azyx-1 expression.

• Primary Identifier: Expr1150986
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2036352
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1032994
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr16431
• Pattern: ZYX-1 (cp415 ) is expressed in dorsal and ventral epidermal cells. Strikingly, ZYX-1 showed a pattern complementary to that of TES-1 (Expr16430): whereas mNG::TES-1 showed strong expression in seam cells, ZYX-1 was expressed strongly within nonseam cells. mNG::ZYX-1 is recruited to both dorsal-seam and seam-ventral junctions, and it also co-localizes with circumferential filament bundles (CFBs).

• Primary Identifier: Expr2018214
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1013161
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1796
• Remark: Original chronogram file: chronogram.708.xml
• Reporter Gene: [F42G4.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1846
• Remark: Original chronogram file: chronogram.755.xml
• Reporter Gene: [F42G4.3:gfp] transcriptional fusion.

29 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006999
• Start: 13057152
• End: 13071513
• Strand: 1

29 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 14362

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00031658
• WBStrain00035659
• WBStrain00036164
• WBStrain00002940
• WBStrain00002902

0 Upstream Intergenic Region