WormMine: Gene WBGene00007555

• WormBase Gene ID: WBGene00007555
• Gene Name: dohh-1
• Sequence Name: C14A4.1
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable deoxyhypusine monooxygenase activity and iron ion binding activity. Predicted to be involved in peptidyl-lysine modification to peptidyl-hypusine. Predicted to be located in cytoplasm. Expressed in head. Is an ortholog of human DOHH (deoxyhypusine hydroxylase).
• Biotype: SO:0001217
• Genetic Position: II :3.11416 ±0.004166
• Length (nt): 1091

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00007555

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C14A4.1.1	C14A4.1.1	997	II: 10579955-10581045

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C14A4.1	C14A4.1	897	II: 10579978-10580045

9 RNAi Result

• WBRNAi00082396
• WBRNAi00008386
• WBRNAi00040466
• WBRNAi00071787
• WBRNAi00028857
• WBRNAi00071211
• WBRNAi00001133
• WBRNAi00024548
• WBRNAi00023044

20 Allele

• gk963801
• gk963053
• gk962682
• gk963998
• WBVar02068196
• gk347
• WBVar00228482
• gk578165
• gk689972
• gk505953
• gk341009
• WBVar00175206
• gk322587
• gk812452
• gk398
• gk153204
• gk153206
• gk153205
• gk685083
• gk398211

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00007555
• Start: 10579955
• End: 10581045
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_10581046..10581132
• Length (nt): 87
• Chromosome Location: II: 10581046-10581132
• Organism: Caenorhabditis elegans

159 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression in pri-1(RNAi) animals comparing to in N2 animals fed with empty vector.	Differential expression analysis was performed quasi-likelihood F-test with the generalized linear model (GLM) approach in edgeR ver 3.32.1. FDR < 0.05, fold change > 2.	WBPaper00066418:pri-1(RNAi)_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Transcripts that showed significantly increased expression in hda-1(RNAi) embryos comparing to control animals.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00067044:hda-1(RNAi)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
starvation 12 hours	Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals.	EdgeR, FDR < 0.05, fold change >= 2.	WBPaper00067259:starvation_upregulated_intestine
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly increased expression in rsks-1(ok1255) animals after 4 hours of feeding of starvation-induced arrested L1, comparing to N2 animals that went through the same treatment.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067518:rsks-1(ok1255)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in daf-2(e1370;mes-1(bn84ts) comparing to in mes-1(bn84ts).	DESeq2 was used for differential expression analysis. A BenjaminiHochberg multiple hypothesis-corrected P-value cutoff of 0.05 was used as a significance cutoff.	WBPaper00049368:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:oocyte_vs_mitosis_upregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome

7 Expression Patterns

• Primary Identifier: Expr5264
• Remark: Also expressed in (comments from author) : 2 unidentified cells in larval head Strain: BC14409
• Reporter Gene: [C14A4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCATTTCCGTTACCATTTTACTTC] 3' and primer B 5' [CGACGATCTTTCCCGTTG] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; unidentified cells in head

• Primary Identifier: Expr1033251
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2011024
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1021989
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram804
• Remark: Original chronogram file: chronogram.1845.xml
• Reporter Gene: [C14A4.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1144530
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2029261
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

11 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00007555
• Start: 10579955
• End: 10581045
• Strand: 1

11 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1091

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00036162
• WBStrain00036057
• WBStrain00003024

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_10579794..10579954
• Length (nt): 161
• Chromosome Location: II: 10579794-10579954
• Organism: Caenorhabditis elegans