WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00008990 Gene Name  smgl-1
Sequence Name  ? F20G4.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable SNARE binding activity. Involved in nuclear-transcribed mRNA catabolic process. Predicted to be part of Dsl1/NZR complex. Human ortholog(s) of this gene implicated in infantile liver failure syndrome. Is an ortholog of human NBAS (NBAS subunit of NRZ tethering complex). Biotype  SO:0001217
Genetic Position  I :2.39872 ±0.004103 Length (nt)  ? 8066
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00008990

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F20G4.1.2 F20G4.1.2 5144   I: 7918438-7926503
Transcript:F20G4.1.1 F20G4.1.1 5049   I: 7918447-7926338
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F20G4.1 F20G4.1 4848   I: 7918647-7918874

19 RNAi Result

WormBase ID
WBRNAi00095574
WBRNAi00025153
WBRNAi00025154
WBRNAi00003408
WBRNAi00066785
WBRNAi00085366
WBRNAi00045141
WBRNAi00064941
WBRNAi00091113
WBRNAi00071650
WBRNAi00093538
WBRNAi00031187
WBRNAi00071025
WBRNAi00071026
WBRNAi00116764
WBRNAi00117458
WBRNAi00069878
WBRNAi00069876
WBRNAi00110833

83 Allele

Public Name
gk962858
gk962706
gk963902
gk963849
gk964316
gk962622
WBVar00244324
otn13987
WBVar02122342
otn19258
WBVar02072895
WBVar02122343
gk328604
gk115911
gk883639
gk115912
gk840430
gk115913
WBVar01340500
gk340938
gk115914
gk538726
gk115907
gk644066
gk115908
gk582164
gk115909
gk428765
gk115910
gk376031

1 Chromosome

WormBase ID Organism Length (nt)
I Caenorhabditis elegans 15072434  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00008990 7918438 7926503 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_7918342..7918437   96 I: 7918342-7918437 Caenorhabditis elegans

99 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts that showed significantly increased expression in xrep-4(lax137). DESeq2. Genes were selected if their p value < 0.01. WBPaper00066062:xrep-4(lax137)_upregulated
  Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:Cisplatin_downregulated_WT
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
Bacteria: B.thuringiensis Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. Cuffdiff WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background. DESeq2, FDR < 0.05 WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_downregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_E
  Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:spr-1(ok2144)_upregulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (FLT) starting at L1 lava stage. DESeq WBPaper00053302:alovudine_24h_regulated
  Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2. DESeq2 Benjamini-Hochberg adjusted p-value < 0.05. WBPaper00049545:jmjd-3.1(+)_upregulated
  Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2. DESeq2 Benjamini-Hochberg adjusted p-value < 0.05. WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated
  Transcripts that showed significantly increased expression in sur-5p::jmjd-1.2 comparing to in N2. DESeq2 Benjamini-Hochberg adjusted p-value < 0.05. WBPaper00049545:sur-5p-jmjd-1.2(+)_upregulated
  Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector. Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples. WBPaper00051039:germline_enriched
  Transcripts that showed significantly decreased expression in sek-1(km4) animals comparing to in N2 animals under both dietary (DR, OP50 OD = 0.1) and ad libtum (AL, OP50 OD = 3) conditions from 3-day post L4 till 6-day post L4 adult hermaphrodite stage. Bioconductor package edgeR, p < 0.05. WBPaper00056443:sek-1(km4)_downregulated
Bacteria infection: Xenorhabdus nematophila Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila. Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets. WBPaper00041606:CE_X.nematophila_regulated
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the 3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-EtBr-exposed_51h
UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed under EtBr treatment and UVC exposure vs under UVC exposure but without EtBr treatment at the -3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:UVC-EtBr-exposed_vs_UVC-exposed_51h
  Genes identified as down-regulated at a 5% false discovery rate through RNAseq experiments with three tatn-1(qd182) and three N2 RNA samples. ANOVA with FDR <= 0.05. WBPaper00044656:tatn-1(qd182)_downregulated

10 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC15893 [F20G4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCCAATTCTTATCCATTCCC] 3' and primer B 5' [CATATGCGCGATTCTGTAAAAA] 3'. Expr5810 Adult Expression: pharynx; intestine; gonad sheath cells; Nervous System; head neurons; Larval Expression: pharynx; intestine; developing uterus; Nervous System; head neurons;  
Strain: BC15787 [F20G4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCCAATTCTTATCCATTCCC] 3' and primer B 5' [CATATGCGCGATTCTGTAAAAA] 3'. Expr5809 Adult Expression: pharynx; Larval Expression: pharynx; intestine;  
    Expr2034149 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1033913 Tiling arrays expression graphs  
Original chronogram file: chronogram.1731.xml [F20G4.1:gfp] transcriptional fusion. Chronogram701    
Original chronogram file: chronogram.1710.xml [F20G4.1:gfp] transcriptional fusion. Chronogram681    
    Expr2015916 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1015643 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
tested both with a GFP:: SMGL-1 translational fusion and a 2xFLAG::SMGL-1 allele -no allele ID assigned by the authors.   Expr16220   SMGL-1 resides in the ER-Golgi intermediate compartment.
    Expr1149086 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

4 GO Annotation

Annotation Extension Qualifier
  part_of
  involved_in
  involved_in
  enables

4 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00008990 7918438 7926503 -1

4 Ontology Annotations

Annotation Extension Qualifier
  part_of
  involved_in
  involved_in
  enables

2 Regulates Expr Cluster

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with significant decrease of expression in NBAS smgl-1(RNAi) comparing to control. Bioconductor package LIMMA was used to determine differentially expressed genes. The P-values were adjusted for multiple testing with a false-discovery rate (50). Probe sets with fold-change > 1.5 and q-value < 0.05 were used as a cut-off for C. elegans microarrays WBPaper00042561:smgl-1(RNAi)_downregulated
  Genes with significant increase of expression in NBAS smgl-1(RNAi) comparing to control. Bioconductor package LIMMA was used to determine differentially expressed genes. The P-values were adjusted for multiple testing with a false-discovery rate (50). Probe sets with fold-change > 1.5 and q-value < 0.05 were used as a cut-off for C. elegans microarrays WBPaper00042561:smgl-1(RNAi)_upregulated

1 Sequence

Length
8066

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00037717

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_7926504..7926622   119 I: 7926504-7926622 Caenorhabditis elegans