WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00008128 Gene Name  srab-12
Sequence Name  ? C47A10.6 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in head and neurons. Biotype  SO:0001217
Genetic Position  V :13.2016 ±0.00058 Length (nt)  ? 3374
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00008128

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C47A10.6.1 C47A10.6.1 1223   V: 17780269-17783642
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C47A10.6 C47A10.6 1041   V: 17780448-17780582

2 RNAi Result

WormBase ID
WBRNAi00042641
WBRNAi00029888

160 Allele

Public Name
gk963271
gk963489
gk963304
gk963637
gk964050
gk962704
gk962630
WBVar01692932
WBVar01977087
WBVar01977088
WBVar01977089
WBVar01977090
WBVar01977091
WBVar01977092
WBVar01654184
WBVar01654185
WBVar01654182
WBVar01654183
WBVar01654180
WBVar01654181
gk949619
gk949623
gk949622
gk949621
gk949620
gk949626
gk949625
gk949624
WBVar01829142
WBVar01596069

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00008128 17780269 17783642 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_17779523..17780268   746 V: 17779523-17780268 Caenorhabditis elegans

75 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
Bacteria infection: Photorhabdus luminescens Genes down-regulated in animals infected with Photorhabdus luminescens compared to the E. coli OP50 control after 24h of infection. MAANOVA and BRB-Array-Tools. WBPaper00030985:Photorhabdus_luminescens_downregulated
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:ubc-9(ne4833)_upregulated
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
Starvation Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl) DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:starvation_regulated_LowSalt
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
Temprature shift to 28C for 24 hours. Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 24 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_24h_upregulated
Temprature shift to 28C for 48 hours. Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_48h_upregulated
  Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_E
  Embryonic (E) subclasses are based on the earliest significant increase(abbreviated pi for primary increase). A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_E_pi(122_min)
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva stage Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0129. WBPaper00040858:eQTL_regulated_juvenile
UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at just prior to the third UVC dose (48h). Genes differentially expressed under EtBr treatment and UVC exposure vs under UVC exposure but without EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:UVC-EtBr-exposed_vs_UVC-exposed_48h
  Genes up-regulated in wdr-23(tm1817) mutants comparing to in N2. Differentially expressed genes at false discovery rate (FDR) of 0.05 were identified using the Cuffdiff module of the Cufflinks package. WBPaper00042215:wdr-23(tm1817)_upregulated
  Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells). Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations. WBPaper00025141:unc-4::GFP_Expressed_Genes
  Transcripts depleted in Q cell. DESeq2 (version 2.11.40.7) FDR < 0.05, fold change > 2. WBPaper00066652:Q-cell_depleted
  Transcripts uniquely expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_enriched
  Embryonic Pan-neural Enriched Genes. A two-class unpaired analysis of the data was performed to identify genes that differ by >= 1.5-fold from the reference at a FDR of <1% for the larval pan-neural, embryonic pan-neural, and larval A-class motor neuron datasets. WBPaper00030839:Embryo_Pan_Neuronal
  Genes with expression level regulated by genotype (N2 vs CB4856) at Old adults stage (214 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0136. WBPaper00040858:eQTL_regulated_old

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : IL1 + IL2 labial neurons (Thomas Lab 2005). Good expression. Strain: BC12597 [C47A10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTCTGCCAAAACAAGGAAA] 3' and primer B 5' [CCTGGGAGCCAGTGATTCT] 3'. Expr5523 Adult Expression: Nervous System; head neurons; amphids; labial sensilla; neurons along body; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; labial sensilla; neurons along body; tail neurons; phasmids;  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12012 [C47A10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTCTGCCAAAACAAGGAAA] 3' and primer B 5' [CCTGGGAGCCAGTGATTCT] 3'. Expr5521 Adult Expression: Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; unidentified cells in head; Larval Expression: Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; unidentified cells in head;  
Strain: BC12174 [C47A10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTGTTGTTGCCGGAAGTTA] 3' and primer B 5' [TCCAATTCTTTGGAGTGTTCAA] 3'. Expr5522 Adult Expression: Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons;  
    Expr2034390 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr3135 C47A10.6 expressed in both head (labial) and tail neurons (phasmid PHCL/R). C47A10.6 also showed medium to strong expression in scattered nonchemosensory neurons.  
    Expr2016159 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1026431 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1146628 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
Original chronogram file: chronogram.24.xml [C47A10.6:gfp] transcriptional fusion. Chronogram1278    

2 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00008128 17780269 17783642 -1

2 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
3374

1 Sequence Ontology Term

Identifier Name Description
gene  

4 Strains

WormBase ID
WBStrain00062393
WBStrain00001987
WBStrain00002221
WBStrain00002047

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_17783643..17784514   872 V: 17783643-17784514 Caenorhabditis elegans