WormMine: Gene WBGene00011587

• WormBase Gene ID: WBGene00011587
• Gene Name: anp-1
• Sequence Name: T07F10.1
• Organism: Caenorhabditis elegans
• Automated Description: Enables metalloaminopeptidase activity. Predicted to be involved in peptide catabolic process and proteolysis. Predicted to be located in cytoplasm; extracellular space; and membrane. Human ortholog(s) of this gene implicated in several diseases, including severe acute respiratory syndrome; severe pre-eclampsia; and uterine disease (multiple). Is an ortholog of several human genes including ANPEP (alanyl aminopeptidase, membrane); ENPEP (glutamyl aminopeptidase); and LNPEP (leucyl and cystinyl aminopeptidase).
• Biotype: SO:0001217
• Genetic Position: V :4.71864±
• Length (nt): 4394

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00011587

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T07F10.1a.1	T07F10.1a.1	3278	V: 12859444-12863837
Transcript:T07F10.1b.1	T07F10.1b.1	3234	V: 12859534-12863829

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T07F10.1b	T07F10.1b	2931	V: 12859534-12859679
CDS:T07F10.1a	T07F10.1a	2967	V: 12859444-12859479

4 RNAi Result

• WBRNAi00001874
• WBRNAi00052768
• WBRNAi00018376
• WBRNAi00089152

75 Allele

• gk963271
• gk963301
• gk964458
• gk964459
• gk963693
• WBVar01868534
• WBVar01868535
• WBVar01868536
• WBVar01868537
• WBVar01868533
• WBVar01868538
• WBVar01868539
• WBVar01868540
• WBVar01868541
• WBVar01868542
• gk949078
• h5465
• h16998
• gk760793
• gk594624
• gk407465
• gk576813
• gk510870
• gk330281
• gk786814
• gk629129
• gk747155
• gk743056
• gk598735
• gk320127

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00011587
• Start: 12859444
• End: 12863837
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

244 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:female_vs_male_downregulated
Starvation	Starvation-induced transcripts that showed significantly increased expression in post dauer animals comparing to wild type control.	edgeR	WBPaper00053713:Starvation-induced_postdauer_vs_control_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Transcripts that showed significantly increased expression in prg-1(tm872) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:prg-1(tm872)_upregulated

7 Expression Patterns

• Primary Identifier: Expr6631
• Remark: Strain: BC14025
• Reporter Gene: [T07F10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGGACGAAGAGAATAAGCTCG] 3' and primer B 5' [CATGAACACAGTGAGAAAACGAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; excretory cell; Nervous System; tail neurons; Larval Expression: pharynx; intestine; excretory cell; Nervous System; tail neurons

• Primary Identifier: Expr1035106
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2024187
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1156376
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2005972
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1825
• Remark: Original chronogram file: chronogram.736.xml
• Reporter Gene: [T07F10.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1023723
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

18 GO Annotation

40 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00011587
• Start: 12859444
• End: 12863837
• Strand: 1

18 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in anp-1(ok608) comparing to in N2 at L4 or young adult stage.	EdgeR, Bonferroni-corrected p-value <= 0.05.	WBPaper00058886:anp-1(ok608)_downregulated
	Transcripts that showed significantly increased expression in anp-1(ok608) comparing to in N2 at L4 or young adult stage.	EdgeR, Bonferroni-corrected p-value <= 0.05.	WBPaper00058886:anp-1(ok608)_upregulated

1 Sequence

• Length: 4394

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00031517

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_12854867..12859443
• Length (nt): 4577
• Chromosome Location: V: 12854867-12859443
• Organism: Caenorhabditis elegans