WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00011737 Gene Name  sqst-1
Sequence Name  ? T12G3.1 Brief Description  sqst-1 encodes a protein with similarity to mammalian sequestosome 1(SQSTM1)/p62, a signal transduction or adaptor protein involved in receptor-mediated signalling pathways; SQST-1 is weakly expressed in embryos and exhibits a diffuse, cytoplasmic localization; SQST-1 is selectively removed by autophagy during embryogenesis.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable K63-linked polyubiquitin modification-dependent protein binding activity and protein kinase C binding activity. Predicted to be involved in aggrephagy; endosome organization; and mitophagy. Located in cytoplasm. Expressed in several structures, including head; hypodermal cell; muscle cell; tail; and vulva. Used to study amyotrophic lateral sclerosis. Human ortholog(s) of this gene implicated in Paget's disease of bone 3; distal myopathy with rimmed vacuoles; and neurodegenerative disease (multiple). Is an ortholog of human SQSTM1 (sequestosome 1).
Biotype  SO:0001217 Genetic Position  IV :5.51952±
Length (nt)  ? 2610
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00011737

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T12G3.1a.1 T12G3.1a.1 2253   IV: 12034282-12036891
Transcript:T12G3.1b.1 T12G3.1b.1 1866   IV: 12034807-12036720
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T12G3.1a T12G3.1a 2082   IV: 12034282-12034450
CDS:T12G3.1b T12G3.1b 1866   IV: 12034807-12036564

5 RNAi Result

WormBase ID
WBRNAi00053225
WBRNAi00018644
WBRNAi00033299
WBRNAi00114688
WBRNAi00113609

53 Allele

Public Name
gk964278
gk964078
gk964500
gk962765
gk964475
gk964320
gk962528
gk964340
ttTi25015
gk960101
WBVar01772276
ok2869
WBVar01858941
ok2892
gk213874
gk213877
WBVar02121882
gk213878
gk213875
gk213876
WBVar01731245
WBVar01803775
gk388447
gk640523
gk870404
gk355977
gk756887
gk394952
gk920337
gk780070

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00011737 12034282 12036891 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_12036892..12038979   2088 IV: 12036892-12038979 Caenorhabditis elegans

346 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Genes that were upregulated in lin-15B(n744). For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. WBPaper00038168:lin-15B(n744)_upregulated
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_upregulated
Heat shock: 35C for 1 hour. Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour. The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01. WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
Heat shock: 35C for 1 hour. Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite N2 animals were exposed to 35C for 1 hour. The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01. WBPaper00065749:Heat-Shock_upregulated_N2
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. DESeq2(v1.32.0), FDR < 0.05. WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
  Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva. DESeq2 1.26.0, fold change > 2, FDR < 0.05. WBPaper00064539:nhr-114(gk849)_upregulated
  Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage. DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05 WBPaper00064632:daf-2(e1370)_upregulated_intestine
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated

19 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034346 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Strain: BC10729 [T12G3.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGTCCGTAATAGATTGCTTTG] 3' and primer B 5' [TGGAGAATAATGCAACAACAAAA] 3'. Expr6684 Adult Expression: intestine; Reproductive System; vulval muscle; spermatheca; Nervous System; head neurons; neurons along body; unidentified cells; Larval Expression: intestine; seam cells; Nervous System; head neurons; neurons along body; tail neurons; unidentified cells;  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12921 [T12G3.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGTCCGTAATAGATTGCTTTG] 3' and primer B 5' [TGGAGAATAATGCAACAACAAAA] 3'. Expr6685 Adult Expression: Nervous System; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; head neurons; neurons along body; tail neurons;  
    Expr11906 SQST-1::GFP is weakly expressed and diffusely localized in the intestine and muscle cells in wild-type animals.  
    Expr14926 We found SQST-1::GFP to be expressed mainly in punctate structures in head neurons and in the pharynx throughout adulthood.  
    Expr13914 In both non-dauer and dauer animals, SQST-1::GFP is expressed in the pharynx/head, vulva, and tail.  
    Expr9328   T12G3.1 is weakly expressed and diffusely localized in the cytoplasm.
    Expr1035162 Tiling arrays expression graphs  
    Expr14801 In wild-type animals, SQST-1::GFP was weakly expressed and diffusely localized in the cytoplasm.  
    Expr11214   SQST-1 was expressed at low levels in adult animals, where it localized to distinct subcellular sites, referred to as foci.
    Expr1156810 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr10996 SQST-1 is very weakly expressed and diffusely localized in wild-type embryos.  
    Expr2016111 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr12074   SQST-1 is weakly expressed and diffusely localized in the cytoplasm in wild-type embryos and larvae.
    Expr12075 SQST-1 is very weakly expressed in the hypodermal cells in a wild-type larva.  
Original chronogram file: chronogram.72.xml [T12G3.1:gfp] transcriptional fusion. Chronogram1808    
    Expr11759   In wild-type animals, SQST-1::GFP is weakly and diffusely expressed in the cytoplasm from embryonic to adult stages.
    Expr1018617 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr14854   In wild-type animals, SQST-1::GFP is weakly expressed and diffusely localized in the cytoplasm.

12 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  enables

5 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00011737 12034282 12036891 1

12 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
2610

1 Sequence Ontology Term

Identifier Name Description
gene  

3 Strains

WormBase ID
WBStrain00037114
WBStrain00037157
WBStrain00001490

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_12032155..12034281   2127 IV: 12032155-12034281 Caenorhabditis elegans